Forgot your password?
typodupeerror

Breakthrough In Human Genetics 240

Many readers have submitted this story about a breakthrough in our understanding of human DNA: in particular, how much variation can exist between peoples' genes and how genes are involved with certain diseases. "One person's DNA code can be as much as 10 percent different from another's, researchers said on Wednesday in a finding that questions the idea that everyone on Earth is 99.9 percent identical genetically. They said their new version of the human genetic map, or 'book of life,' fills in many missing pages and chapters to explain how genes are involved in common diseases. The Human Genome Project mapped the billions of letters that make up the human genetic code. Scientists later refined the map by looking for single variations called SNPs or single nucleotide polymorphisms. The CNV map gives researchers a different way to look for genes linked to diseases by identifying gains, losses, and alterations in the genome."
This discussion has been archived. No new comments can be posted.

Breakthrough In Human Genetics

Comments Filter:
  • by Harmonious Botch ( 921977 ) * on Thursday November 23, 2006 @01:04AM (#16961622) Homepage Journal
    One person's genetic code can be 10% different from another's, and chimps are 98% the same as humans.
    No wonder so many of you can't spell.
    • by gringer ( 252588 ) on Thursday November 23, 2006 @01:12AM (#16961646)
      My guess is that they're referring to human specific variation, i.e. 10% of the DNA that varies within human populations, rather than variation in all DNA.
      • Re: (Score:2, Funny)

        by bloobloo ( 957543 )
        So you are saying that the DNA that varies in the human population is 10% of the DNA that varies in the human population?
        • Re: (Score:3, Informative)

          by gringer ( 252588 )
          Close. I'm suggesting that perhaps the DNA that varies between two people is 10% of the DNA that varies in the human population.
          • Re: (Score:2, Interesting)

            by TheABomb ( 180342 )
            But for the chimpanzee-human adage to be correct, there would have to be less than 2 percent variation between any two humans. A difference of 10 percent of two percent, 0.2 percent, would still leave everyone at least 99.8 percent the same, and that's hardly newsworthy enough to make a story.

            And if you RTFA, the project apparently only worked with 12 percent of the total DNA. That means that at least there's 1.2 percent difference to work with, unless the supposed 10 percent is actually 5/6 of that 12 pe

    • Re: (Score:3, Funny)

      by bitt3n ( 941736 )
      mad parrot opp!
    • Re: (Score:2, Funny)

      by DarkReign ( 919773 )
      Creationists on slashdot? I thought this place only had smart people.
    • I for one welcome our new ook ook ook ahem chimpanzee overlords.
    • Well I know that the general opinion of the genetic code has been some sort of simple weight of the 4 letters of the code or some pure sequencing data. Well now for the geeks on Slashdot comes a decent translation.

      The genetic code of a person is like a computer program that builds and runs a person. It is the firmware and OS if you will. Without getting too complicated the old method of comparing the code would have been like counting all the instructions in a assembly language program. Then by adding

  • by DrKyle ( 818035 ) on Thursday November 23, 2006 @01:15AM (#16961670)
    Looking at the writeup from Nature [nature.com]. They clearly state that these results point to maybe a 0.5% difference among individuals, or 99.5% identical. That's 20X less variation than this crap article would have you believe. The actual research deals with CNV's = copy number variants. So for a given stretch of DNA, different people in a population might have that region duplicated or triplicated which does not really allow them to make anything different, but it might alter the levels of expression of those genes. As this DNA is found in multiple copies it had largely been believed to have a low number of genes, as is the case of most highly repeated DNA, but the researchers have evidence that these repeated domains do contain a large number of unique genes. In a short summary/analogy:
    Some people are 8 feet tall.
    Some people are 4 feet tall.
    Therefore, people vary in height by 200%.

    It's obvious to see the failed logic in that case, that's the same thing here, just because 10% might potentially be variable, that doesn't mean any single person even exists at each extreme.
    • by Bamafan77 ( 565893 ) on Thursday November 23, 2006 @01:28AM (#16961728)
      Looking at the writeup from Nature. They clearly state that these results point to maybe a 0.5% difference among individuals, or 99.5% identical. That's 20X less variation than this crap article would have you believe.
      Well, to be fair, the Reuters article states that "One person's DNA code can be as much as 10 percent different from another's", not IS 10% different. That seems to cast the statement in the light of "theorhetical upper limit", rather than "absolute truth".
    • by Boghog ( 910236 ) on Thursday November 23, 2006 @03:11AM (#16962240)
      OK, according to the Chromosome FAQs:
      http://www.ornl.gov/sci/techresources/Human_Genome /posters/chromosome/faqs.shtml [ornl.gov]
      The X chromosome comprises ~5% of the genome while the Y chromosome is ~1%. Since women are XX and men are XY, men and women differ by ~6%.
      If chimps are only 2% different from men, then men are more closely related to chimps than women. QED
      • I think your problem is that you are comparing the percentage difference in one gene (XX vs XY), then take the percentage difference of two whole genomes (Human vs Chimp)and presuming that the differences scale accurately. Someone should call the Analogy Police on this.
      • I'm starting to take that seriously, although technically, you mean men are more closely related to male chimps than to women.

        From your numbers, male humans have about 1% of their genes that simply do not exist in female humans. If some genes truely code for behavioral modifiers, then there is a very good chance some of those are found on the Y chromosome. Women can't have those genes, by definition. Ergo, the conclusion should be: If genes sometimes code for behavior, men have a wider range of possible beh
      • by Rakishi ( 759894 )
        Well first of all in women one of the X chromosomes shuts down so at a gene level man and women have the same number of usable X chromosomes. Furthermore the Y is only .38% of the genome AND has a very low number of genes (even for it's size). Also chimps can be both male and female, the 2% comparison is probably using a full genome (X + Y + rest) so comparing a human male to a female chimp would have a larger margin.


    • If there is this much variation between two individuals, does this finally disprove the whole "race" myth once and for all? Appearance only accounts for at most 15% of a persons genes. Since there are no "race specific" genes, and the science is basically saying that there is massive difference between two individuals, when will the religious ideology catch up to the science?

      When are we going to classify people according to their genetic quality/type and not their appearance?
      • Race and genetics (Score:3, Interesting)

        by Dobeln ( 853794 )
        From the article in the Independent referenced elsewhere in this thread:

        http://news.independent.co.uk/world/science_techno logy/article2007490.ece [independent.co.uk]

        "The scientists looked at people from three broad racial groups - African, Asian and European. Although there was an underlying similarity in terms of how common it was for genes to be copied, there were enough racial differences to assign every person bar one to their correct ethnic origin. This might help forensic scientists wishing to know more about the race o
  • by circletimessquare ( 444983 ) <`moc.liamg' `ta' `erauqssemitelcric'> on Thursday November 23, 2006 @01:17AM (#16961680) Homepage Journal
    i remember reading that humans and chimps are 98% the same

    and previous to this announcement, all people were 99.9% the same

    the implication here is that people are actually as low as 99% the same

    which means one crazy ass inference:

    it should be possible to find two people and a chimp such that and person A is equally different from the chimpanzee as he is from the person B

    no way
  • by Anonymous Coward on Thursday November 23, 2006 @01:18AM (#16961684)
    No, no, no, no, no... this is all just a misunderstanding of scientifical facts. You see, it's only the darker folks, whom we are 10% different from, that are 2% different from monkeys. The world was made this way intentionally, presumably by some Great, Omnipotent Designer... whatever you want to call him. I know this to be true because I learned it in a museum. In Kentucky. It was right next to the exhibit with humans and dinosaurs living together.

    Honestly folks, get it together already.
  • by Salvance ( 1014001 ) * on Thursday November 23, 2006 @01:18AM (#16961686) Homepage Journal
    If there is so much variation between humans, how does this impact future genetic therapies? Wouldn't we need to map each person's genome, then study the impact of disease on each of the genes, to understand what gene therapies would work best for an individual? This article seems to suggest that the everyday "We've found the gene that causes " claims are only true for a subset of the population.
    • umm how to start.. The guts of the matter are that having more genetic information about someone is usually usefull. The more we discover the more we can determine the effacacy of different medications.. if someone is missing a receptor for morphine then it's just going to give them constipation.

      The CNV variations wouldnt show that something is missing, but it might help with dosing requirements. If there are more copies of a blood clotting factor in a person who has just survived a mild stroke, the

  • Um... not quite. (Score:5, Interesting)

    by Punchcardz ( 598335 ) on Thursday November 23, 2006 @01:22AM (#16961704)
    "One person's DNA code can be as much as 10 percent different from another's, researchers said on Wednesday in a finding that questions the idea that everyone on Earth is 99.9 percent identical genetically." It doesn't call it into question at all. The simple matter is that how you define "different" and measure the percentages makes a big difference. The human genome is ~3 billion base pairs. You can have a singe nucleotide change in a gene of say 5000 base pairs. When you compare a given gene between individuals, do you count the whole gene as being entirely different? Or do you say that it is 99.98% (4999/5000) the same?
  • Gene Expression? (Score:2, Interesting)

    by foobsr ( 693224 ) *
    It is always interesting to see how they ignore gene expression, the role of the extracellular matrix (where much of it happens), the importance of mechanotransduction (tensegrity, see Ingber) and thus posture (as a way to cope with gravity as a constant stimulus) when it comes to causes for deseases.

    Well, salesdroids of the pharmaceutical industry, IMHO.

    CC.
    • Dude, I have no idea what you are bitching about. 1. Gene expression is one of the most active areas of research, pharmacagenomics is actively being researched. Have you even heard of Gleevec? Cures people with a specific mutation? 2. It is WAY easier/cheaper/more standard to measure gene expression than to sequence them. 3. How tensegrity plays into signal transduction / gene expression is still unknown. 4. The ECM is an active area of research and drug targets for cancerand clotting. ....And if you s
  • God vs Man (Score:4, Interesting)

    by eebra82 ( 907996 ) on Thursday November 23, 2006 @01:52AM (#16961836) Homepage
    Does anyone know what stance our major religions have on DNA? For example, how should a true Christian receive this news?

    I know it's not entirely on topic, but seeing that the bible describes humans as flesh and blood and as one, it would be interesting to see what this up-to-ten-percent-difference would put science against religious belief.
    • by timmarhy ( 659436 ) on Thursday November 23, 2006 @02:01AM (#16961894)
      picture someone sticking they hands over their ears and yelling LALALALALA I CANT HEAR YOU, and you will know the religous stance
    • by A beautiful mind ( 821714 ) on Thursday November 23, 2006 @02:19AM (#16961968)
      There are even scarier truths in science. Imagine this:

      100% of the atoms making us up are DIFFERENT. No two person has the exact SAME atoms!!

      Oh please say it ain't true! Say it ain't true! Now I will have to meditate for half an hour in my religious beliefs just to be able to breath again!
      • Say it ain't true! Now I will have to meditate for half an hour in my religious beliefs just to be able to breath again!

        Watch carefully now, children. We're about to see a fine example of natural selection at work...

    • The Christian tinge in my background doesn't seem to object to the notion of DNA. How exactly is it contradicting the bible?
      • by mgblst ( 80109 )
        Not being Christian, there might just be a chance that he hasn't read the Bible.

        It seems to a lot of people that when you are talking to a Christian, you have no idea what they believe, since they seem to cherry pick what scientific evidence they are willing to accept. So you neve have any idea how to talk or argue to them. The problem has existed for 100 of years, since before Galileo.
    • They should receive it the same way as everyone else unless they are idolaters of the written word :P
    • Well,

      Actually Christianity is a general term for the group of people that follow Jesus. There are several Christian religions, you just can't put all of them in the same pack! Maybe in the USA there's only the Catholics and the Protestants... but even among these two there is a lot of difference on their beliefs.

      And elsewhere in the world there's even more Christian religions! For example, here at Brazil we have Umbanda[1] and Candomblé[2], two Christian religions that mix the Catholic and African trad
    • Re: (Score:2, Funny)

      by bazorg ( 911295 )
      For example, how should a true Christian receive this news?

      I'm not religious, but let me try: Adam was created by God using mud from a river bank. The materials available in common earth are not different from the ones found in a human body.

      All the matter in the Universe was concentrated in one single place and time, then it exploded and eventually became all the stars, planets and creatures we know today. God is everywhere and we all are part of God.

      Simple creatures evolve to become complex creatures. If

    • not that i'm at all religious, but you really are grasping at straws. i'm sure this news has absolutely no implication on what the bible says whatsoever.

      "the bible describes humans as flesh and blood and as one"

      What, are you implying that christians believe humanity is one giant homogenous blob of flesh? Or that we are all clones? We illusions of theirs does this 10% threaten to shatter?
  • At Last (Score:4, Funny)

    by umbrellasd ( 876984 ) on Thursday November 23, 2006 @01:53AM (#16961842)
    My brother is explained...
  • by opencity ( 582224 ) on Thursday November 23, 2006 @01:54AM (#16961854) Homepage
    "Everyone on the earth is unique,
    except this one guy ..."
  • by Bob54321 ( 911744 ) on Thursday November 23, 2006 @01:59AM (#16961874)
    That 10% is way off. There is on average a variable base (across all people) every 300 bases. So by my calculations, people are at least 1 - 1/300 = 99.7% similar. Not everyone can be different everywhere so that gets us back in the 99.9% territory. The copy number variation map has not changed those numbers that much...
  • 1 million monkeys randomly typing typewriters = 1 shakespeare manuscript created

    monkeys and humans 98% the same, and this new genetic analysis indicates human up to 10% different, or, only 90% the same

    therefore, 98%-90% = 8% difference in monkey versus human random shakespeare manuscript creation

    8% of 1 million is 8,000

    therefore, 8,000 more monkeys than humans are required to produce one shakespeare manuscript

    it's a scientific fact folks

    (as well as all other "facts" gleaned from this 10% number in the article)
    • A trillion atoms bouncing around, randomly stuck together, formed a humanoid being and actually did write the complete works of Shakespeare! If that isn't evidence of Intelligent Design I don't know what is.

       
    • 1 million geeks typing and mouse-clicking not-so-randomly = slashdot effect

      I doubt you could herd a bunch of monkeys together and do the same, unless Slashdot started posting articles about bananas
    • Re: (Score:2, Informative)

      by varghan ( 834564 )
      I object to the statement

      1 million monkeys randomly typing typewriters = 1 shakespeare manuscript created

      My keyboard has 103 keys. Placing a 1e6 monkeys behind 1e6 of these computer would generate a 1/103 = 0.009 chance for hitting the exact right key. The chance of generating for example Titus Andronicus (140.187 characters, including spaces) is therefore (1/103)^140187. Nearly infinite I would say. Even generating Sonnet XVIII, Shall I compare thee to a summer's day (614 characters including spaces) would need 103^614 monkeys, again infinite. One million monkeys, using 1e6 computers

  • Billions of letters? Billions of nucleotides, sure, but they're represented by four different letters last I checked.
    • Easy solution... wc utility to the rescue, and have it report on the number of characters.

      wc -m mydna

      Does it return a huge number, or 4?
       
  • 10% variation (Score:3, Interesting)

    by goldcd ( 587052 ) on Thursday November 23, 2006 @02:39AM (#16962092) Homepage
    doesn't mean anything unless it's 10% of the genome that's actually expressed, or if it is creates a functionally different protein. Working on the assumption that we do actually evolve, then we'd need to have sections of DNA that can alter without having an immediate effect - like a scribble pad where stuff could just be doodled.
  • by mveloso ( 325617 ) on Thursday November 23, 2006 @03:22AM (#16962286)
    Even if two genomes are 100% the same, that doesn't mean that the products of each will be the same.

    Why? Gene expression can differ depending on environmental factors.

    As a simple analogy, your DNA = a cookbook. While many recipies are cooked automatically by the systems in your body, other recipies are cooked or not cooked depending on the environment in which the organism finds itself.

    I haven't read a good article on gene expression, really. Various mechanisms are alluded to in the literature, but it seems to be unclear how gene expression is or is not triggered. More specifically, researchers seem to know that this particular mechanism turns a given gene on or off, but how that mechanism is triggered is unknown (or not the focus of the article/research).

    Also, I'd guess that environmental gene expression stars in the womb - that the fetus gets clues to the external environment from the nutrients and chemicals coming from the mother and adjusts itself accordingly. You could test that by somehow getting ahold of some in-vitro twins and implanting them at different times, I guess? But there probably still would be too many variables.
    • by KokorHekkus ( 986906 ) on Thursday November 23, 2006 @06:38AM (#16962990)
      Also, I'd guess that environmental gene expression stars in the womb - that the fetus gets clues to the external environment from the nutrients and chemicals coming from the mother and adjusts itself accordingly. You could test that by somehow getting ahold of some in-vitro twins and implanting them at different times, I guess? But there probably still would be too many variables.
      There was a very interesting BBC documentary "The Ghost In Your Genes" (http://www.bbc.co.uk/sn/tvradio/programmes/horizo n/ghostgenes.shtml [bbc.co.uk]) where they mentioned several interesting results about environmental effects on gene expression. In the program (and linked BBC article) one researcher mentions that he could turn some gene expression on and off in mice embryos by physically manipulating the embryos.

      One very interesting thing they also talked about was the possible transgenerational effects by famine as an example of how environments affects the human organism. Överkalix in far northern Sweden was very isolated so there were struck by famine several times. Being Swedes they were also kept very good records of births, deaths etc. A researcher decided to look at the health of those families over 3 generations. I'd say they found something quite astounding: there was a link in grandmothers food supply and their granddaugters mortality rate, same for grandfathers and their grandsons (the link was either all on the male line or all on the female line).

      For those who wish to read a little more about the transgenerational the researchers has written an (non-scholar) article at the University of Bristols website http://www.bris.ac.uk/news/2005/866 [bris.ac.uk]. I think there will a lot of really interesting developments in the gene expression research in the coming years.
    • "I haven't read a good article on gene expression, really. Various mechanisms are alluded to in the literature, but it seems to be unclear how gene expression is or is not triggered. More specifically, researchers seem to know that this particular mechanism turns a given gene on or off, but how that mechanism is triggered is unknown (or not the focus of the article/research)."

      I honestly don't know what it is you've been reading. Does the JAK/STAT system ring a bell..? the MAP Kinase cascade..? Or how about
  • If we're only 3% different from chimpanzees, then 10% between humans is significant. It would tend to indicate that evolution is at play, which is something I've long suspected. Evolution doesn't happen all at once, it starts with a positive trait and then over time spreads out among descendants.
  • Better Article (Score:5, Informative)

    by BrickM ( 178032 ) on Thursday November 23, 2006 @03:34AM (#16962336)
    http://news.independent.co.uk/world/science_techno logy/article2007490.ece [independent.co.uk]

    This piece gets a few of the key facts correct where reuters went wrong, such as the already-mentioned "10% vs 10x" difference between individuals. It's a great read!
  • gtagcgtagatagctctagctagcttaggagcttagaggcgcttagatcg cgatcga
  • by Jugalator ( 259273 ) on Thursday November 23, 2006 @05:05AM (#16962644) Journal
    Example of a 10% different human [google.com].
  • If I can get some gene therepy to customise my already fairly unique, I'll have created something new and can thus patent myself? Cool! That will stop those pesky cloners.
  • "Race is a social construct" -- well ok, it can be categorized via a laboratory test with 99.7% accuracy. And human biodiversity is simply a matter of a disappearingly small percentage of genes -- well ok maybe 10 times that amount and well, ok, ok, a significant fraction of the difference between humans and other great apes. And all of this "error" is biased toward the "genes don't matter" camp during the peak of boomer fertility when de facto polygyny (misnamed "serial monogamy" by the same academic auth
  • 100% of these comparative studies are highly speculative. Take into account: 10% of the DNA codes for proteins (this DNA was sequenced in HUGO on which most comparative studies were based) 90% was named junk-DNA, but isn't really. It is now recognized that it is functional in the sense that it regulates the expression of other genes. This DNA can differ a lot more among individuals and species. The functions of 'junk'-DNA are only partially known, but it is clear that in addition to some proteins (express

In the sciences, we are now uniquely priviledged to sit side by side with the giants on whose shoulders we stand. -- Gerald Holton

Working...