Longest Email Disclaimer Awards

evilandi writes: "The Register have announced the results of their Longest Email Disclaimer awards (2001 Daftas). The winner was financiers UBS Warburg with 1081 words, adding nearly seven kilobytes to every email they send." Any really good examples? Post them below. Law firms seem to be the worst offenders.

Re:Encryption?

Last year I had all my email blocked for "inappropriate content" until I spoke to an administrator. I called the person listed for more information and was told that "encrypted text is not allowed for security purposes." I told them it wasn't encrypted, it was compressed, it was a ZIP file! The idiot told me, "We know, we unzipped it and we couldn't read it so it's still encrypted. You'll have to send it as plain text."

I tried to explain to the idiot that the file was a code dump from a 2M EPROM chip being sent back to the manufacturer to be checked for errors and modified. THERE WAS NO PLAINTEXT! But she still wouldn't listen to me. "We have strict security policies regarding encrypted content. NO EXCEPTIONS!"

Called the manufacturer and they suggested I do a hex dump and try sending that. It also was blocked as "inappropriate content." Then tried to FTP it to the manufacturer's site but found that FTP was also blocked.

Ended up having to use Laplink to transfer the file to a borrowed laptop, sneak the laptop out of the building, take it home and Laplink it into my home machine just so I could email the file to the manufacturer. By the time the modified file was sent back to me at home I had found a program called Split that would break the file up into pieces small enough to fit on a floppy. Would have worked great except I couldn't install Split on the NT machine at work without administrator privileges. (@%#%$#$%!!!) Still had to laplink it over from a borrowed laptop.

Now I've learned my lesson and moved the development/programming system over to a machine not on the network with it's own free (Bluelight) Internet service. All of this is against company policy; no non-networked machines, no OS except NT, no modems, no open (non-passworded access) machines... Sheesh!

However, we have no problem accepting any and all viruses through Outlook (or LookOut! as we tend to call it), crippling out email 3 times in the last 2 years. Is your company being run by idiots, too?

Re:Rather pointless

If you want someone to read it, thus respecting it, KISS

Agreed. Legal disclaimers are a nightmare dreamed up by lawyers to keep themselves in a job. If they absolutely have to be there (and it's my view that they don't), then they should simply be a reference to the full small print:

A disclaimer applies to all email sent from Example, Inc. For the full text, see http://www.example.com/legal/

Have disclaminers ever _worked_ in court?

Apart from the obesity of this particular disclaimer, has text of this nature ever been used successfully as a defense against any type of legal action, be it a civil suit or a government enforcement action? Can anyone point to any examples of disclamiers being accepted or rejected by a court?

sPh

and that's not the worst...

We are dealing with a group within UBS Warburg at work at the moment, and not only do they have the huge disclaimer, but whatever mail software they use structures mails thusly:

1) Plain text section - big-ass disclaimer only
2) 1 or more arbitrarily name RTF files for the body, and possibly the message being replied to

I think it's HP OpenMail, but whatever it is, it really sucks.

Re:Genetic Enginerds...

Well, you'd never catch me doing that. I sure as hell wouldn't want to give anyone who intercepted my email the information they require to clone me! The NSA would have a fucking field day!

God, imagine what havoc an Evil Dodger would cause. Or a Minidodger! One eighth my size - a bit to my byte!

D.

Stupid Email Disclaimers

The most sensible analysis (from a UK perspective) of email disclaimers is on the Stupid Email Disclaimers [goldmark.org] web site. Its contains a bit of logical (and legal) analysis, some sample disclaimers and some parodies as well.

Someone pointed it out on an email list when the Registers story first came out.

Encryption?

Notice in the "Most PC Disclaimer" award:

Employees must never send or store e-mails or attachments that are obscene, indecent, sexist, racist, defamatory, abusive, in breach of copyright, encrypted or otherwise inappropriate.

(emphasis mine)

Does this strike anyone else as unusually facist? They are lumping privacy into the list of "naughty" types of email. Has anyone else heard of a company that forbids using encryption?

What about SSL or SSH?

Taking responsibility?

From UBS AG's (AKA UBS SA, AKA UBS Warburg) disclaimer:

E-mail transmission cannot be guaranteed to be secure or error-free as information could be intercepted, corrupted, lost, destroyed, arrive late or incomplete, or contain viruses. The sender therefore does not accept liability for any errors or omissions in the contents of this message which arise as a result of e-mail transmission.

Wow! I'm stunned that they would send out every message basically saying, "we get ``viruses'' and our users pass them on; we don't care, you're on your own."

I've always been the champion of RFC 1855 [faqs.org] AKA the nettiquite guidelines. And I quote:

* If you include a signature keep it short. Rule of thumb is no longer than 4 lines. Remember that many people pay for connectivity by the minute, and the longer your message is, the more they pay.

WWW Disclaimers

That article also talked about WWW disclaimers. I personally like the one used on the Oklahoma State University's Tuba section website [geocities.com]. Warning, this may only be funny to fellow tuba players. :)

--

Wasted bandwidth...

I subscribe to several development newgroups. <Sarcasm>There's nothing I like more than a message to the newgroup that

1. Was sent in both text and HTML
2. Has a 20 line legal disclaimer at the end
3. Quotes four or five other messages verbatim, each of which ...
4. Has a 20 line legal disclaimer at the end
5. Has a 100k uuencoded attachment of a totally irrelevant log message attached
6. Asks a question answered in the FAQ on the homepage

</Sarcasm>
And people wonder why we need faster routers....

On the validity of legal agreements in e-mail

By reading this comment, you agree to sell your first-born to Jacob Lee of Cincinnati, OH.

This comment must be destroyed within 30 minutes of reading under full penalty of U.S. law. The editors of this site shall be held responsible if this comment is not removed at the end of the appropriate time period.

This agreement is not applicable in the states of New Jersey, Maryland, and Delerium.

All Your First Born are Belong to Us
--

Re:To disclaim the infinite...

Each disclaimer represented a particular way in which an attorney's client had previously been screwed

This is so true. I love reading the small print on products to find exactly what some stupid people have done with them. "Do not insert forcibly into body cavities","Not to be used for drying pets", etc.

My favorite disclaimer was from a local brewery who were giving out scratch cards to win a free T-shirt. It said something like:

This offer valid until we

• Run out of T-shirts (definitely)
• Run out of scratch cards (probably)
• Run out of beer (unlikely!)

Re:Genetic Enginerds...

Dude...you married a fruit fly (Drosophila melanogaster)! At least that's according to the BLAST [nih.gov] search at NCBI...

law firms and email disclaimers

Law firms seem to be the worst offenders.

Wouldn't you seize the opportunity to advertise your work in every email you send?

Yeah...

I hate long disclaimers...

--
This post has been prepared by the division, group, subsidiary or affiliate of ralmeida AG ("ralmeida") identified herein. In certain countries ralmeida AG is referred to as ralmeida SA, which is a translation of ralmeida AG, its registered legal name. ralmeida Warburg is a business group of ralmeida AG. This post is for distribution only under such circumstances as may be permitted by applicable law, including the following: This post has no regard to the specific investment objectives, financial situation or particular needs of any specific recipient. The post is published solely for informational purposes and is not to be construed as a solicitation or an offer to buy or sell any securities or related financial instruments. The securities described herein may not be eligible for sale in all jurisdictions or to certain categories of investors. The post is based on information obtained from sources believed to be reliable but is not guaranteed as being accurate, nor is it a complete statement or summary of the securities, marketsor developments referred to in the post. The post should not be regarded by recipients as a substitute for the exercise of their own judgement. Any opinions expressed in this post are subject to change without notice and ralmeida is not under any obligation to update or keep current the information contained herein. ralmeida and/or its directors, officers and employees may have or have had interests or long or short positions in, and may at any time make purchases and/or sales as principal or agent, or ralmeida may act or have acted as market-maker in the relevant securities or related financial instruments discussed in this post. Furthermore, ralmeida may have or have had a relationship with or may provide or has provided corporate finance, capital markets and/or other financial services to the relevant companies. Employees of ralmeida may serve or have served as officers or directors of the relevant companies. ralmeida may rely on information barriers, such as "Chinese Walls," to control the flow of information contained in one or more areas within ralmeida, into other areas, units, divisions, groups, or affiliates of ralmeida. Options, derivative products and futures are not suitable for all investors, and trading in these instruments is considered risky. Past performance is not necessarily indicative of future results. Foreign currency rates of exchange may adversely affect the value, price or income of any security or related instrument mentioned in this post. Clients wishing to effect transactions should contact their local sales representative. ralmeida accepts no liability whatsoever for any loss or damage of any kind arising out of the use of all or any part of this post. Additional information will be made available upon request. EEA: This post has been issued by ralmeida Warburg Ltd., regulated in the UK by the Securities and Futures Authority. In the UK this post is for distribution to persons who are not UK private customers. Customers should approach the analyst(s) named on the cover regarding the contents of this post. For investment advice, trade execution or any other queries, customers should contact their London representative. Switzerland: This post is being distributed in Switzerland by ralmeida AG. Italy: Should persons receiving this research in Italy require additional information or wish to effect transactions in the relevant securities, they should contact either Giubergia ralmeida Warburg SIM SpA, an associate of ralmeida SA, in Milan or ralmeida Warburg (Italia) SIM SpA, a subsidiary of ralmeida SA, in Milan or its London or Lugano Branch. South Africa: ralmeida Warburg Securities (South Africa) (Pty) Ltd. (incorporating J.D. Anderson & Co.) is a member of the JSE Securities Exchange SA. United States: This post is being distributed to US persons by either ralmeida Warburg LLC or by ralmeida PaineWebber Inc., subsidiaries of ralmeida AG; or (ii) by a division, group, subsidiary or affiliate of ralmeida AG, that is not registered as a US broker-dealer (a "non-US affiliate"), to major US institutional investors only. ralmeida Warburg LLC or ralmeida PaineWebber Inc. accepts responsibility for the content of a post prepared by another non-US affiliate when distributed to US persons by ralmeida Warburg LLC or ralmeida PaineWebber Inc. All transactions by a US person in the securities mentioned in this post must be effected through ralmeida Warburg LLC or ralmeida PaineWebber Inc., and not through a non-US affiliate. Canada: This post is being distributed by ralmeida Bunting Warburg Inc., a subsidiary of ralmeida AG and a member of the principal Canadian stock exchanges & CIPF. A statement of its financial condition and a list of its directors and senior officers will be provided upon request. Singapore: This post is being distributed in Singapore by ralmeida Warburg Pte. Ltd. Hong Kong: This post is being distributed in Hong Kong to investors who fall within section 3(1) of the Securities Ordinance (Cap 333) by ralmeida Warburg Asia Limited. Japan: This post is being distributed in Japan by ralmeida Warburg (Japan) Limited to institutional investors only. Australia: This post is being distributed in Australia by ralmeida Warburg Australia Limited in relation to fixed income securities, and ralmeida Warburg Australia Equities Limited in relation to equity securities. New Zealand: This post is being distributed in New Zealand by ralmeida Warburg New Zealand Ltd in relation to fixed income securities and ralmeida Warburg New Zealand Equities Ltd in relation to equity securities. + 2001. All rights reserved. No part of this post may be reproduced or distributed in any manner without the written permission of ralmeida. ralmeida specifically prohibits the re-distribution of this post, via the Internet or otherwise, and accepts no liability whatsoever for the actions of third parties in this respect. Visit our website at http://www.ubswarburg.com This message contains confidential information and is intended only for the individual named. If you are not the named addressee you should not disseminate, distribute or copy this e-mail. Please notify the sender immediately by e-mail if you have received this e-mail by mistake and delete this e-mail from your system. E-mail transmission cannot be guaranteed to be secure or error-free as information could be intercepted, corrupted, lost, destroyed, arrive late or incomplete, or contain viruses. The sender therefore does not accept liability for any errors or omissions in the contents of this message which arise as a result of e-mail transmission. If verification is required please request a hard-copy version. This message is provided for informational purposes and should not be construed as a solicitation or offer to buy or sell any securities or related financial instruments.

--

Proposed Church of Scientology Disclaimer

All thoughts expressed within this message are those of The Church of Scientology and in no way represent the free will of the sender of this email. The Church of Scientology doesn't approve of using nuclear weapons to attack The Church of Scientology. The Curch of Scientology reserves the right to take part of that last sentence out of context in a court of law if this email is delivered to anyone not affiliated with The Curch of Scientology. If you are not the intended recipient of this email we will sue.

To disclaim the infinite...

Some years ago, I came into the position of regularly reviewing a type of contract in which attorneys invariably attached a rider with their disclaimers.

After reviewing the first contract, I was impressed by the attorney's disclaimer, and his insight into ways in which his client could be screwed. Surely, I had not foreseen those factors. The next contract had a similarly insightful disclaimer, although it pointed out very different issues to be disclaimed.

Having now reviewed scores of these contracts over many years, I have learned several things:

• Every disclaimer was new and different from any prior disclaimer
• Each disclaimer represented a particular way in which an attorney's client had previously been screwed
• There are an infinite number of ways in which to screw somebody without violating the letter of a contract

All this gives way to an important truth about contracts: the words only stand up by the goodwill of the parties behind them, and similarly, cannot withstand the force of an able party who wants out. In the fast-paced exchange of internet communications, it amazes me that attorneys don't realize that their technical disclaimers zoom by without any real meeting of the minds, and therefore, create no basis for a meaningful contract.

<bart

Re:Two Words

I don't think that these reports need to have these types of legal messages tagged to them. I tend to disagree with these types of messages altogether!

All content, references, and ideas presented in this post are copyright 2001, grammar nazi. All rights reserved. You may reference or quote this comment in your own comment on Slashdot, however your PROHIBITED from quoting, referencing, or using ideas contained herein on other web forumns, both public and private. If you wish to print out the contents of this message and page. Please contact the grammar nazi at [e-mail] [mailto].

Genetic Enginerds...

A friend of mine (ok, my ex-wife!) is a genetic engineer... her sig file read:

Jane Doe
Office: 770.555.1212
Mobile: [phone]
DNA Seq :
tcgactgactgactggcgcgatcgacgagctcgatcgagaggctacgc gc
gactgactgactggcgcgatcgacgagctcgatcgagaggctacgcgc ga
gcgcgatcgacgagctcgatcgagaggctacgcgcgatattatcgcga tc
tatcgcgatcgactgactgactggcgcgatcgacgagctcgatcgaga gg
tcgactgactgactggcgcgatcgacgagctcgatcgagaggctacgc gc
gactgactgactggcgcgatcgacgagctcgatcgagaggctacgcgc ga
gcgcgatcgacgagctcgatcgagaggctacgcgcgatattatcgcga tc
tatcgcgatcgactgactgactggcgcgatcgacgagctcgatcgaga gg
tcgactgactgactggcgcgatcgacgagctcgatcgagaggctacgc gc
gactgactgactggcgcgatcgacgagctcgatcgagaggctacgcgc ga
gcgcgatcgacgagctcgatcgagaggctacgcgcgatattatcgcga tc
tatcgcgatcgactgactgactggcgcgatcgacgagctcgatcgaga gg
...

You get the idea.

---
WWJD! WWJD! WWJD!

And the lawyers always get their tithe.

Without all of the frivolous lawsuits abounding, disclaimers would not be necessary. Frivolous lawsuits exist because judges (x-lawyers) allow lawyers to bring idiotic things to court and win. The only way to be sure that you are not open to litigation from a lawyer is to hire another lawyer to look over your correspondence (and write disclaimers). No matter what, a lawyer gets money. It is a pretty good self perpetuating scam. Maybe I should have been a lawyer.
-CrackElf