Forgot your password?
typodupeerror
It's funny.  Laugh.

Longest Email Disclaimer Awards 130

evilandi writes: "The Register have announced the results of their Longest Email Disclaimer awards (2001 Daftas). The winner was financiers UBS Warburg with 1081 words, adding nearly seven kilobytes to every email they send." Any really good examples? Post them below. Law firms seem to be the worst offenders.
This discussion has been archived. No new comments can be posted.

Longest Email Disclaimer Awards

Comments Filter:
  • by Anonymous Coward on Tuesday May 22, 2001 @06:15AM (#206494)
    Last year I had all my email blocked for "inappropriate content" until I spoke to an administrator. I called the person listed for more information and was told that "encrypted text is not allowed for security purposes." I told them it wasn't encrypted, it was compressed, it was a ZIP file! The idiot told me, "We know, we unzipped it and we couldn't read it so it's still encrypted. You'll have to send it as plain text."

    I tried to explain to the idiot that the file was a code dump from a 2M EPROM chip being sent back to the manufacturer to be checked for errors and modified. THERE WAS NO PLAINTEXT! But she still wouldn't listen to me. "We have strict security policies regarding encrypted content. NO EXCEPTIONS!"

    Called the manufacturer and they suggested I do a hex dump and try sending that. It also was blocked as "inappropriate content." Then tried to FTP it to the manufacturer's site but found that FTP was also blocked.

    Ended up having to use Laplink to transfer the file to a borrowed laptop, sneak the laptop out of the building, take it home and Laplink it into my home machine just so I could email the file to the manufacturer. By the time the modified file was sent back to me at home I had found a program called Split that would break the file up into pieces small enough to fit on a floppy. Would have worked great except I couldn't install Split on the NT machine at work without administrator privileges. (@%#%$#$%!!!) Still had to laplink it over from a borrowed laptop.

    Now I've learned my lesson and moved the development/programming system over to a machine not on the network with it's own free (Bluelight) Internet service. All of this is against company policy; no non-networked machines, no OS except NT, no modems, no open (non-passworded access) machines... Sheesh!

    However, we have no problem accepting any and all viruses through Outlook (or LookOut! as we tend to call it), crippling out email 3 times in the last 2 years. Is your company being run by idiots, too?
  • ...if someone would post some kind of small reply to this article, and then, get this, make some kind of funny disclaimer at the end of his message! Hilarious! I wonder if anyone else has though of that?!

    :)
  • E-mail transmission cannot be guaranteed to be secure or error-free as information could be intercepted, corrupted, lost, destroyed, arrive late or incomplete, or contain viruses

    Even worse than M$ saying that outlooks sending of worms is a positive feature...
    :-)
  • Your sig bugs me.
    Bad commentry *is* worse than nothing. Even better than good comments, is code which needs less commentry.
    Perfection would be attained when no comments are necessary at all, but this, like most forms of perfection is unattainable.
  • That area is a little murky at best. On one hand they can claim copyright to whatever they wrote and hence tell you what can and cannot be done with it.

    On the other hand there was some mention early this year (during the cucat fiasco) of a section in the postal code prohibiting such restrictions on stuff you send unsolicited. But alas, that's a snail main regulation.
  • by Tet ( 2721 ) <slashdot.astradyne@co@uk> on Tuesday May 22, 2001 @03:55AM (#206499) Homepage Journal
    If you want someone to read it, thus respecting it, KISS

    Agreed. Legal disclaimers are a nightmare dreamed up by lawyers to keep themselves in a job. If they absolutely have to be there (and it's my view that they don't), then they should simply be a reference to the full small print:

    A disclaimer applies to all email sent from Example, Inc. For the full text, see http://www.example.com/legal/
  • by sphealey ( 2855 ) on Tuesday May 22, 2001 @04:57AM (#206500)
    Apart from the obesity of this particular disclaimer, has text of this nature ever been used successfully as a defense against any type of legal action, be it a civil suit or a government enforcement action? Can anyone point to any examples of disclamiers being accepted or rejected by a court?

    sPh
  • We are dealing with a group within UBS Warburg at work at the moment, and not only do they have the huge disclaimer, but whatever mail software they use structures mails thusly:

    1) Plain text section - big-ass disclaimer only
    2) 1 or more arbitrarily name RTF files for the body, and possibly the message being replied to

    I think it's HP OpenMail, but whatever it is, it really sucks.
  • Opinions expressed may not even be my own, let alone
    those of any organisations, nations, species or
    schools of thought to which I may be affiliated.
  • Okay, everybody who thinks the next april first RFC should be a protocol for email disclaimers, raise your hand.

    The frightening part is, I know an awful lot of librarians who would implement it. (The people who run html verifiers against their web pages and then proudly display a logo indicating they have end of paragraph tags.)

    Speed of light. Conservation of mass. Bureaucracy. Some things are just constant...

    Rob

  • Don't need to pick holes in the legal disclaimer, you haven't agreed to it. Granted, it's a violation of copyright to forward it, but they can't stop you disclosing the contents.

    Even if you did forward it and violate copyright, they wouldn't win anything as damages, a private message email has almost negligent value. (The actual message has almost no value, instead of the information, which you can give away anyway.)

    -David T. C.

  • by The Dodger ( 10689 ) on Tuesday May 22, 2001 @07:08AM (#206505)

    Well, you'd never catch me doing that. I sure as hell wouldn't want to give anyone who intercepted my email the information they require to clone me! The NSA would have a fucking field day!

    God, imagine what havoc an Evil Dodger would cause. Or a Minidodger! One eighth my size - a bit to my byte!

    D.

  • by Dusty ( 10872 ) on Tuesday May 22, 2001 @05:21AM (#206506) Homepage

    The most sensible analysis (from a UK perspective) of email disclaimers is on the Stupid Email Disclaimers [goldmark.org] web site. Its contains a bit of logical (and legal) analysis, some sample disclaimers and some parodies as well.

    Someone pointed it out on an email list when the Registers story first came out.

  • by Stiletto ( 12066 ) on Tuesday May 22, 2001 @04:14AM (#206507)
    Notice in the "Most PC Disclaimer" award:

    Employees must never send or store e-mails or attachments that are obscene, indecent, sexist, racist, defamatory, abusive, in breach of copyright, encrypted or otherwise inappropriate.

    (emphasis mine)

    Does this strike anyone else as unusually facist? They are lumping privacy into the list of "naughty" types of email. Has anyone else heard of a company that forbids using encryption?

    What about SSL or SSH?
  • Looks like they expect everyone to have a T1. I suppose there is no such thing as a short message from this company. If you did write a short two line e-mail, I suppose the content would get lost with the legal spam added to the end of the e-mail.
  • And as for the judges, the judge that found McDonalds liable for not warning some (fully grown and presumably employed) idiot that coffee is hot

    Some facts:
    McDonald's coffee was hot enough to cause second and third degree burns. McDonald's serves hundreds of thousands of cups of coffee per day. No human being is perfect.

    Conclusion: an accident will occur, and someone will be severely burned.

    When this happened, the woman asked McDonald's to cover part of her medical expenses. Not all of them, just part - she was willing to accept that she was partially responsible for the accident, and she wasn't asking for compensation for 'pain and suffering.' McDonalds repeatedly and disrespectfully refused.

    So she sued. She got her medical bills paid, she got her 'pain and suffering', and McDonalds was penalized for giving customers a product that they KNEW their customers would hold in their laps and that they KNEW could cause severe tissue damage.
  • I do not feel that they were negligent in not telling people that boiling water is hot.
    True. They were negligent in not telling people that they were being served boiling water. Rational people don't drink boiling water. I understand completely McD's reasons for serving ultra-hot coffee, but they need to be prepared to pay for the consequences of their actions.

    While I would agree that she had a case for medical expenses, I do not feel that the US courts should serve the same purpose as the lottery.
    Yup. Gotta agree with you there. ACTUAL damages should be paid; compensation for pain and suffering and emotional distress is iffy. Punitive damages are right out.

    If a company has done something wrong and deserves to pay punitive damages, then those damages should go to a charity, or the local community, or the Federal treasury. But there is NO reason for a company to pay ME punitive damages. If someone robs my house and the judge sentences them to $a 50,000 fine and five years at hard labor, do I get the cash and the results of his work? Should I? Why then should civil damages be different?
  • Digital signatures would be useful, but not many companies use them/ they aren't as widespread as they should be.

    On a different note, anyone know whether those disclaimers would stand up in court, like you can't forward it blah...blah...

    Like postal mail, noone can tell me what I can or cannot do with stuff which lands in my mailbox. If its so important, then why are you stupid enough to send it to me? Anyone a lawer?
  • Should trap all such disclaimed messages and refuse to forward them to the intended recipients or bounce them to the senders until they receive written confirmation from an authorized executive of whatever company originated the mail.

    Translation: Make the bozo that established the policy approve the transmission of every copy of every email sent with the disclaimer.

  • If you want someone to read it, thus respecting it, KISS"
    I believe that they think that people actually do read it. Notice that this is way down near the end:
    Visit our website at http://www.ubswarburg.com
    That's an invitation which should be in the first line of the notice. For that matter, the second-to-last paragraph says this message is only for the person named -- although by the time one reads down to that whomever is reading it has absorbed the information, whether it's intended for them or not.
  • This is exactly the kind of information that should be encoded according to RFC 1437 [ic.ac.uk].

  • ... and he works for UBS Warburg [ubswarburg.com].

    Code commentary is like sex.
    If it's good, it's VERY good.

  • Wow...that sounds like a story line to a Dilbert episode!

  • From UBS AG's (AKA UBS SA, AKA UBS Warburg) disclaimer:

    E-mail transmission cannot be guaranteed to be secure or error-free as information could be intercepted, corrupted, lost, destroyed, arrive late or incomplete, or contain viruses. The sender therefore does not accept liability for any errors or omissions in the contents of this message which arise as a result of e-mail transmission.

    So wrong, so wrong... How can information contain viruses? It cannot. It is the carrier which contains those viruses, and only certain specific carriers at that. If they really cared about not sending out those viruses, they would use a carrier which does not allow executable content. Like, say... ASCII text.

    Of course, they're in the financial sector, so they're probably shackled and tied to the upgrade vortex from Redmond. Bummer, I say.

  • Ah, everyone has DSL these days. That RFC is out of date :-)
  • Actually, it's even worse now that flat rates are the norm. You pay what amounts to a tax on your Internet connection. It's not called out on any bill or otherwise made clear, but when an ISP has a .1-.5% load from crap like vcards, signatures, etc (I don't know the stats either, so I could be way off), they have to buy larger pipe a little bit sooner, and you pay a little bit more.

    Ok, so perhaps it ammounts to a fraction of a dollar a month for the average home user. But, why should I be taxed for your footers? Just slap a URL on your messages and make the page as beefy as you like.
  • by ajs ( 35943 ) <ajs@NospAM.ajs.com> on Tuesday May 22, 2001 @03:40AM (#206520) Homepage Journal
    From UBS AG's (AKA UBS SA, AKA UBS Warburg) disclaimer:
    E-mail transmission cannot be guaranteed to be secure or error-free as information could be intercepted, corrupted, lost, destroyed, arrive late or incomplete, or contain viruses. The sender therefore does not accept liability for any errors or omissions in the contents of this message which arise as a result of e-mail transmission.
    Wow! I'm stunned that they would send out every message basically saying, "we get ``viruses'' and our users pass them on; we don't care, you're on your own."

    I've always been the champion of RFC 1855 [faqs.org] AKA the nettiquite guidelines. And I quote:
    * If you include a signature keep it short. Rule of thumb is no longer than 4 lines. Remember that many people pay for connectivity by the minute, and the longer your message is, the more they pay.

  • I attach this to all my personal messages. IANAL but I married one...

    No disclaimer shall be read or observed. Any person (either corporate or individual) making any statement shall be held civily and criminally liable as a party to any act I may do while following the intentional, implied or inferred (whether correctly or not) directions from said statement. So there.

    That way it's your fault if you reply to it and I screw up.
  • by macdaddy ( 38372 ) on Tuesday May 22, 2001 @08:01AM (#206522) Homepage Journal
    That article also talked about WWW disclaimers. I personally like the one used on the Oklahoma State University's Tuba section website [geocities.com]. Warning, this may only be funny to fellow tuba players. :)

    --

  • A friend of mine works for an insurance company in Italy (AXA Assicurazioni), and the disclaimer is printed in Italian, English and French:

    Questo messaggio è riservato; il suo contenuto non rappresenta
    in nessun caso un impegno da parte di AXA Assicurazioni, AXA SIM,
    od AXA REIM, ad eccezione di quanto previsto in accordi conclusi
    per iscritto tra voi ed AXA Assicurazioni, AXA SIM o AXA REIM.
    Qualsiasi pubblicazione, utilizzo o diffusione, anche parziale di
    questo messaggio, deve essere preventivamente autorizzata. Nel
    caso in cui non foste destinatari del presente messaggio,vogliate
    cortesemente avvertire immediatamente il mittente.

    Ce message est confidentiel; son contenu ne represente en aucun
    cas un engagement de la part de AXA Assicurazioni, AXA SIM ou AXA
    REIM sous reserve de tout accord conclu par ecrit entre vous et
    AXA Assicurazioni, AXA SIM ou AXA REIM. Toute publication,
    utilisation ou diffusion, meme partielle, doit etre autorisee
    prealablement. Si vous n' etes pas destinataire de ce message,
    merci d'en avertir immediatement l'expediteur.

    This message is confidential; its contents do not constitute a
    commitment by AXA Assicurazioni, AXA SIM or AXA REIM, except
    where provided for in a written agreement between you and AXA
    Assicurazioni, AXA SIM or AXA REIM. Any unauthorised disclosure,
    use or dissemination, either whole or partial, is prohibited. If
    you are not the intended recipient of the message, please notify
    the sender immediately.
  • I saw this on the other site [kuro5hin.org] yesterday.
  • It's fun to point out spelling errors, (forumns) in posts from a grammar nazi.
  • Working in the Health care field that disclaimer is Required to be attached to all fax/mail documents. We don't email documents (yet), so it's not on the outgoing email yet.
  • ...this is from someone who uses 32-bit encryption. I hope that's not your *private* key ;-)
  • Think of how many spams could have been sent with all that wasted bandwidth!
  • just adding a link to a big disclaimer ? Maybe just a line like :
    Reading this message assumes you've read http://...
    That's funny anyway. Basically, emails disclaimers are saying "warning : maybe the content of this message has been modified by a third party" .
    But well... why would the third party modify the message body but leave the disclaimer ?
    That's pointless.
    To send a message that has to be trusted :
    • Send a mail to the recipient with a link. The link should point to a web server that belongs to the company of the mail sender.
    • Have the recipient follow the link and fetch the message through HTTPS.
    • The mail content can't be forged (excepted if the mail/web servers got rooted) .
    • The sender knows that the recipient has read the message. He knows when. He knows from which IP it happened. If he feels paranoid, he can allow browsing messages only after authentication or specific IP.

    But of course, spammers may use this to validate addresses they have sent fake important messages to. Fighting spammers stupidity is an endless war.

  • Under US Code Title 47, Sec.227(b)(1)(C), Sec.227(a)(2)(B) This email
    address may not be added to any commercial mail list with out my
    permission. Violation of my privacy with advertising or SPAM will
    result in a suit for a MINIMUM of $500 damages/incident, $1500 for
    repeats.
  • ...is it now OK to link to The Register now that Mike Magee doesn't work there anymore? OK, so I don't read Slashdot that religiously anymore, but I can't remember the last time I saw a story linked to there from here.

    Or maybe there's a large conspiracy against the poor man by Slashdot, Intel, Microsoft, and the Bavarian Illuminati. Well, maybe not. But there could be!

    OK, I'll get get some sleep now. But not after I link to Mike's new page. [theinquirer.net]

  • Disclaimers [ashleypomeroy.com]

    This page contains a collection of corporate email disclaimers, preserved intact for future generations, as of 19/04/01. All contents (sic). Lest we forget.

    Among other things, this page [ashleypomeroy.com] has an earlier and much shorter version of the UBS warburg disclaimer. Apparently it has been growing -- run away! run away!

  • Why the hell did this get marked as redundant?

    Aside from the fact that moderators are generally clueless. Either that or Michael is on the loose again.
  • This was at the end of an email sent to me from an outside firm. It's not my companies (thank god(s)) but I figured it should be added to the mix:

    This electronic mail message and any attached files contain information intended
    for the exclusive use of the individual or entity to whom it is addressed and
    may contain information that is proprietary, privileged, confidential and/or
    exempt from disclosure under applicable law. If you are not the intended
    recipient, you are hereby notified that any viewing, copying, disclosure or
    distribution of this information may be subject to legal restriction or
    sanction. Please notify the sender, by electronic mail or telephone, of any
    unintended recipients and delete the original message without making any copies


    As long as we're on the subject of emails, though, I should point out that even worse than HTML mail and 7K legal mumbo-jumbo is:
    embedded Flash sig files!

    I kid you not:
    http://www.cetan.com/flash-email/flash-email.html [cetan.com]
    There are 3 screen shots from this flash embedded email.

  • I thought someone on Slashdot had better notice that too. I just saw that and almost flipped. "encrypted or otherwise inappropriate" strikes me as an odd way to phrase it, but it points out one thing -- London's Southwark Council has no clue.
  • Have you considered getting a clue yourself?

    PGP/GPG Key: 0xC2F837FD [keyserver.net].
    Fingerprint = 86EB 2231 AF86 4B7E 46D2 5B10 6072 AE52 C2F8 37FD

    Have a nice day of course ...

  • This e-mail is confidential and solely for the use of the intended
    recipient. If you are not the intended recipient, you are obligated to
    kill yourself and others who might have seen it immediately. Thank you.
  • by wowbagger ( 69688 ) on Tuesday May 22, 2001 @03:51AM (#206538) Homepage Journal
    I subscribe to several development newgroups. <Sarcasm>There's nothing I like more than a message to the newgroup that
    1. Was sent in both text and HTML
    2. Has a 20 line legal disclaimer at the end
    3. Quotes four or five other messages verbatim, each of which ...
    4. Has a 20 line legal disclaimer at the end
    5. Has a 100k uuencoded attachment of a totally irrelevant log message attached
    6. Asks a question answered in the FAQ on the homepage

    </Sarcasm>
    And people wonder why we need faster routers....
  • By reading this comment, you agree to sell your first-born to Jacob Lee of Cincinnati, OH.

    This comment must be destroyed within 30 minutes of reading under full penalty of U.S. law. The editors of this site shall be held responsible if this comment is not removed at the end of the appropriate time period.

    This agreement is not applicable in the states of New Jersey, Maryland, and Delerium.

    All Your First Born are Belong to Us
    --
  • The .sig says: 'You have received email, but your system must first be restarted before this feature can be used.'

    I'm waiting for the day I see: Shutdown and Restart: your system must first be restarted before this feature can be used. Almost as bad as when you get the End Task box for an unnamed task (the shutdown process); ending the task halts the shutdown process and you're right back at the desktop so you hit the pwr and then Win9x blames you for not shutting the system down properly.... you know the drill. Grrr.

  • by Bassthang ( 78064 ) on Tuesday May 22, 2001 @05:03AM (#206541) Homepage
    Each disclaimer represented a particular way in which an attorney's client had previously been screwed

    This is so true. I love reading the small print on products to find exactly what some stupid people have done with them. "Do not insert forcibly into body cavities","Not to be used for drying pets", etc.

    My favorite disclaimer was from a local brewery who were giving out scratch cards to win a free T-shirt. It said something like:

    This offer valid until we

    • Run out of T-shirts (definitely)
    • Run out of scratch cards (probably)
    • Run out of beer (unlikely!)

  • This product is meant for educational purposes only. Any resemblance to real persons living or dead is purely coincidental. Void where prohibited. Some assembly required. List each check separately by bank number. Batteries not included. Contents may settle during shipment. Use only as directed. No other warranty expressed or implied. Do not use while operating a motor vehicle or heavy equipment. Postage will be paid by addressee. Subject to CAB approval. This is not an offer to sell securities. Apply only to affected area. May be too intense for some viewers. Do not stamp. Use other side for additional listings. For recreational use only. Do not disturb. All models over 18 years of age. If condition persists, consult your physician. No user-serviceable parts inside. Freshest if eaten before date on carton. Subject to change without notice. Times approximate. Simulated picture. No postage necessary if mailed in the United States. Please remain seated until the ride has come to a complete stop. Breaking seal constitutes acceptance of agreement. For off-road use only. As seen on TV. One size fits all. Many suitcases look alike. Contains a substantial amount of non-tobacco ingredients. Colors may fade. We have sent the forms which seem right for you. Slippery when wet. For office use only. Not affiliated with the American Red Cross. Drop in any mailbox. Edited for television. Keep cool; process promptly. Post office will not deliver without postage. List was current at time of printing. Return to sender, no forwarding order on file, unable to forward. Not responsible for direct, indirect, incidental or consequential damages resulting from any defect, error or failure to perform. At participating locations only. Not the Beatles. Penalty for private use. See label for sequence. Substantial penalty for early withdrawal. Do not write below this line. Falling rock. Lost ticket pays maximum rate. Your canceled check is your receipt. Add toner. Place stamp here. Avoid contact with skin. Sanitized for your protection. Be sure each item is properly endorsed. Sign here without admitting guilt. Slightly higher west of the Mississippi. Employees and their families are not eligible. Beware of dog. Contestants have been briefed on some questions before the show. Limited time offer, call now to ensure prompt delivery. You must be present to win. No passes accepted for this engagement. No purchase necessary. Processed at location stamped in code at top of carton. Shading within a garment may occur. Use only in a well-ventilated area. Keep away from fire or flames. Replace with same type. Approved for veterans. Booths for two or more. Check here if tax deductible. Some equipment shown is optional. Price does not include taxes. No Canadian coins. Not recommended for children. Prerecorded for this time zone. Reproduction strictly prohibited. No solicitors. No alcohol, dogs or horses. No anchovies unless otherwise specified. Restaurant package, not for resale. List at least two alternate dates. First pull up, then pull down. Call toll free number before digging. Driver does not carry cash. Some of the trademarks mentioned in this product appear for identification purposes only. Objects in mirror may be closer than they appear. Record additional transactions on back of previous stub. Unix is a registered trademark of AT&T. Do not fold, spindle or mutilate. No transfers issued until the bus comes to a complete stop. Package sold by weight, not volume. Your mileage may vary. Known as Hellman's east of the Rockies. Beware of greeks bearing gifts. Beware of gifts bearing greeks. This side up. Don't take any wooden nickels. Don't take candy from strangers. Void where prohibited. Caveat Emptor (Buyer beware) Caveat Vendor (Beware of street people). Donde esta el bano. Beware of DOS. Look both ways before crossing the street. Always wear safety belt. Always wear deodorant. Don't forget to breathe. If you park, don't drink...accidents cause people. This supersedes all previous notices. This disclaimer may not be copied without the expressed written consent of whoever I stole it from.

  • Are we to hail this as the start of a new beautiful friendship between Slashdot and El Reg? Will we see an end to the bitchy backstabbing on both sides (but that was blatently started by Slashdot, The Reg being a better quality and funnier news site and all that)?

    One can dream I suppose.

    xxx Stuii!
  • by upstateguy ( 90019 ) on Tuesday May 22, 2001 @08:59AM (#206544)
    Dude...you married a fruit fly (Drosophila melanogaster)! At least that's according to the BLAST [nih.gov] search at NCBI...

  • ....are nearly as annoying as people who span their comments over the title and body of their posts.

    NOTE: The information in this post is confidential and may be legally privileged. If you are not the intended recipient, you must not read, use or disseminate that information. Although this post and any attachments are believed to be free of any virus, or any other defect which might affect any computer or IT system into which they are received and opened, it is the responsibility of the recipient to ensure that they are virus free and no responsibility is accepted by NTSwerver for any loss or damage arising in any way from receipt or use thereof.

    NTSwerver is a bored person. A list of the names of bored persons is open to inspection in your dreams.

    This message has been checked for all known viruses by UUNET delivered through the MessageLabs Virus Control Centre. For further information visit http://www.virus.net/products/security/virus/

    ----------------------------
  • A few months ago I received an e-mail with the following disclaimer:

    "The sender believes that this E-mail and any attachments were free of any virus, worm, Trojan horse, and/or malicious code when sent. This message and its attachments could have been infected during transmission. By reading the message and opening any attachments, the recipient accepts full responsibility for taking protective and remedial action about viruses and other defects. The sender's employer is not liable for any loss or damage arising in any way from this message or its attachments."

    The sender believes the e-mail is free from viruses? Considering most of the recent virus and worm outbreaks are spread without the sender addressing any messages at all, that doesn't offer much consolation. It is even more ridiculous to say that an e-mail "could have been infected during transmission"--like someone is going to intercept a message, infect it, and pass it right on?

    The disclaimer was actually forwarded to me from of my supervisors--thankfully it didn't take much of a debate for me to explain that our company didn't need to tag all of our outgoing mail with the same text.




    ---
  • Yeah, or how about "your PROHIBITED". My prohibited what? :-)

    ChodaBoy
  • by gargle ( 97883 ) on Tuesday May 22, 2001 @05:16AM (#206548) Homepage
    Law firms seem to be the worst offenders.

    Wouldn't you seize the opportunity to advertise your work in every email you send?
  • And everyone who replaces "-----BEGIN PGP MESSAGE-----" with "-----my network admin is an idiot-----" can send out confidential information...
    ---------------------------------- ----
  • By reading this comment, you agree to sell your first-born to Jacob Lee of Cincinnati, OH.

    Of course I agree, I set the price of my first born at $1 trillion. If you are unable to pay the full amount you admit to breach of contract. Furthermore in the event of breach of contract you agree to give me all of your assets, financial or otherwise as damages. Reading this statement is a binding contract under UCITA. You have no chance to survive make your time.

  • by ralmeida ( 106461 ) on Tuesday May 22, 2001 @03:31AM (#206551) Homepage

    I hate long disclaimers...

    --
    This post has been prepared by the division, group, subsidiary or affiliate of ralmeida AG ("ralmeida") identified herein. In certain countries ralmeida AG is referred to as ralmeida SA, which is a translation of ralmeida AG, its registered legal name. ralmeida Warburg is a business group of ralmeida AG. This post is for distribution only under such circumstances as may be permitted by applicable law, including the following: This post has no regard to the specific investment objectives, financial situation or particular needs of any specific recipient. The post is published solely for informational purposes and is not to be construed as a solicitation or an offer to buy or sell any securities or related financial instruments. The securities described herein may not be eligible for sale in all jurisdictions or to certain categories of investors. The post is based on information obtained from sources believed to be reliable but is not guaranteed as being accurate, nor is it a complete statement or summary of the securities, marketsor developments referred to in the post. The post should not be regarded by recipients as a substitute for the exercise of their own judgement. Any opinions expressed in this post are subject to change without notice and ralmeida is not under any obligation to update or keep current the information contained herein. ralmeida and/or its directors, officers and employees may have or have had interests or long or short positions in, and may at any time make purchases and/or sales as principal or agent, or ralmeida may act or have acted as market-maker in the relevant securities or related financial instruments discussed in this post. Furthermore, ralmeida may have or have had a relationship with or may provide or has provided corporate finance, capital markets and/or other financial services to the relevant companies. Employees of ralmeida may serve or have served as officers or directors of the relevant companies. ralmeida may rely on information barriers, such as "Chinese Walls," to control the flow of information contained in one or more areas within ralmeida, into other areas, units, divisions, groups, or affiliates of ralmeida. Options, derivative products and futures are not suitable for all investors, and trading in these instruments is considered risky. Past performance is not necessarily indicative of future results. Foreign currency rates of exchange may adversely affect the value, price or income of any security or related instrument mentioned in this post. Clients wishing to effect transactions should contact their local sales representative. ralmeida accepts no liability whatsoever for any loss or damage of any kind arising out of the use of all or any part of this post. Additional information will be made available upon request. EEA: This post has been issued by ralmeida Warburg Ltd., regulated in the UK by the Securities and Futures Authority. In the UK this post is for distribution to persons who are not UK private customers. Customers should approach the analyst(s) named on the cover regarding the contents of this post. For investment advice, trade execution or any other queries, customers should contact their London representative. Switzerland: This post is being distributed in Switzerland by ralmeida AG. Italy: Should persons receiving this research in Italy require additional information or wish to effect transactions in the relevant securities, they should contact either Giubergia ralmeida Warburg SIM SpA, an associate of ralmeida SA, in Milan or ralmeida Warburg (Italia) SIM SpA, a subsidiary of ralmeida SA, in Milan or its London or Lugano Branch. South Africa: ralmeida Warburg Securities (South Africa) (Pty) Ltd. (incorporating J.D. Anderson & Co.) is a member of the JSE Securities Exchange SA. United States: This post is being distributed to US persons by either ralmeida Warburg LLC or by ralmeida PaineWebber Inc., subsidiaries of ralmeida AG; or (ii) by a division, group, subsidiary or affiliate of ralmeida AG, that is not registered as a US broker-dealer (a "non-US affiliate"), to major US institutional investors only. ralmeida Warburg LLC or ralmeida PaineWebber Inc. accepts responsibility for the content of a post prepared by another non-US affiliate when distributed to US persons by ralmeida Warburg LLC or ralmeida PaineWebber Inc. All transactions by a US person in the securities mentioned in this post must be effected through ralmeida Warburg LLC or ralmeida PaineWebber Inc., and not through a non-US affiliate. Canada: This post is being distributed by ralmeida Bunting Warburg Inc., a subsidiary of ralmeida AG and a member of the principal Canadian stock exchanges & CIPF. A statement of its financial condition and a list of its directors and senior officers will be provided upon request. Singapore: This post is being distributed in Singapore by ralmeida Warburg Pte. Ltd. Hong Kong: This post is being distributed in Hong Kong to investors who fall within section 3(1) of the Securities Ordinance (Cap 333) by ralmeida Warburg Asia Limited. Japan: This post is being distributed in Japan by ralmeida Warburg (Japan) Limited to institutional investors only. Australia: This post is being distributed in Australia by ralmeida Warburg Australia Limited in relation to fixed income securities, and ralmeida Warburg Australia Equities Limited in relation to equity securities. New Zealand: This post is being distributed in New Zealand by ralmeida Warburg New Zealand Ltd in relation to fixed income securities and ralmeida Warburg New Zealand Equities Ltd in relation to equity securities. + 2001. All rights reserved. No part of this post may be reproduced or distributed in any manner without the written permission of ralmeida. ralmeida specifically prohibits the re-distribution of this post, via the Internet or otherwise, and accepts no liability whatsoever for the actions of third parties in this respect. Visit our website at http://www.ubswarburg.com This message contains confidential information and is intended only for the individual named. If you are not the named addressee you should not disseminate, distribute or copy this e-mail. Please notify the sender immediately by e-mail if you have received this e-mail by mistake and delete this e-mail from your system. E-mail transmission cannot be guaranteed to be secure or error-free as information could be intercepted, corrupted, lost, destroyed, arrive late or incomplete, or contain viruses. The sender therefore does not accept liability for any errors or omissions in the contents of this message which arise as a result of e-mail transmission. If verification is required please request a hard-copy version. This message is provided for informational purposes and should not be construed as a solicitation or offer to buy or sell any securities or related financial instruments.

    --

  • what would happen if A LOT OF people sent them an email saying this disclaimer sucks and included the disclaimer in it?
  • Checking my logs, it looks like someone's taken it upon themselves to post this to alt.religion.scientology. Are you trying to get me sued?

    Seriously, I tried looking for it but that's quite a popular group and I don't have the time, so if anyone can tip me off to the thread name I'd appreciate it (in case I need to cover my @$$). Better yet would be a link to the thread on groups.google.com (work won't let me install a newsreader). Cheers. Dr Cheeks.

  • Cheers, AndroidCat. I just figured I'd better make sure there weren't any angry CoS kids suggesting I'm "Fair Game" there or anything.

    I think the case in Cali was an extreme one. Since scientology has a much lower penetration here in the UK, and the courts seem considerably less likely to overreact to something like that, I figure I'm safe from litigation. And if I'm not I can always make use of the ease with which us Europeans can cross borders within the EU, and leg it to Germany : )

    Again, thanks for the heads up; I'm glad you thought the post was funny. And it's increased traffic to my barely-visited site way more than Lycos ever did!

    N.B. The CoS is illegal over in Germany.

  • All thoughts expressed within this message are those of The Church of Scientology and in no way represent the free will of the sender of this email. The Church of Scientology doesn't approve of using nuclear weapons to attack The Church of Scientology. The Curch of Scientology reserves the right to take part of that last sentence out of context in a court of law if this email is delivered to anyone not affiliated with The Curch of Scientology. If you are not the intended recipient of this email we will sue.
  • Balls! If your policy needs 7kB to summarise, you need a new policy. How about this? "UNDER NO CIRCUMSTANCES WHATSOEVER shall email transactions of any sort be considered authoritative or legally binding with respect to (the company), regardless of statements to the contrary." Maybe tweak a few words, but it says pretty much all that has to be said. Hell of a lot less than 7kB, too.
  • Just got Outlook 2k! It's so great, in a not so great sort of way. Well, I'm actually at UBS PaineWebber, the American subsidiary of UBS Warburg.

    As for the other guy, who thought the disclaimer was stupid, these brokers are not terribly computer savy, and so they frequently pass along things like I Love You to their huge several hundred person client lists. Without that disclaimer, UBS Warburg could potentially be liable for any damages caused (despite the fact that the recipient would have to be as stupid as the sender in order to get infected). They still could be, but if they can avoid liability, they will.

    My views may not necessarily reflect those of UBS PaineWebber :)

    The only "intuitive" interface is the nipple. After that, it's all learned.

  • And how about the serious grammatical error concerning the last two sentences: they should be joined as one.
  • by bartwol ( 117819 ) on Tuesday May 22, 2001 @04:00AM (#206559)
    Some years ago, I came into the position of regularly reviewing a type of contract in which attorneys invariably attached a rider with their disclaimers.

    After reviewing the first contract, I was impressed by the attorney's disclaimer, and his insight into ways in which his client could be screwed. Surely, I had not foreseen those factors. The next contract had a similarly insightful disclaimer, although it pointed out very different issues to be disclaimed.

    Having now reviewed scores of these contracts over many years, I have learned several things:

    • Every disclaimer was new and different from any prior disclaimer
    • Each disclaimer represented a particular way in which an attorney's client had previously been screwed
    • There are an infinite number of ways in which to screw somebody without violating the letter of a contract
    All this gives way to an important truth about contracts: the words only stand up by the goodwill of the parties behind them, and similarly, cannot withstand the force of an able party who wants out. In the fast-paced exchange of internet communications, it amazes me that attorneys don't realize that their technical disclaimers zoom by without any real meeting of the minds, and therefore, create no basis for a meaningful contract.

    <bart

  • It's a EULA!

    I'm fully aware of my sig:text ratio...

  • By posting this, you've not only not kept /. free of spelling and grammatical errors, but you've introduced your own spelling and grammatical errors.
  • Text Ganked from: http://www.geocities.com/SunsetStrip/Alley/8069/pr oduct.html

    Product not included. Product may differ from illustration. Not intended for use. Prices may vary. Selection may vary by location. Sales tax will be added to the retail price of all taxable items. Product has been shown to cause Cancer in laboratory animals. The makers of Product are not responsible for loss of hair, injury, or death resulting from the use of Product. Do not put product in mouth, nose, eyes, or other orifices. If contact occurs rinse immediately. If ingestion occurs induce vomiting. Do not place Product in direct sunlight or clean with harsh solvents, as deformation may occur. Dry clean only. Product not fit for human consumption. In countries abiding by the Geneva Convention, Product may not be legal. Product is manufactured by slave labor in such countries where slave labor exists. Product may not function as described. Other Products available. Product may induce epileptic seizures. Street price may vary. All refunds must be accompanied by sales receipt. Not all standards upgradable. Product subject to blackout dates. Receipt of purchase required for purchase. Company is not responsible for omissions or errors in typography or photography. Other Product names are trademark of their respective companies. Product may emit radiation. Not intended for use by children. Extended use may cause blindness or even death. Provided by the management for your protection. If empty please call attendant. Store in a cool dry place. Does not comply with FCC class B radiation emitting device. Authorized for use in military applications. Not for export. Export of product may be considered treason. Do not use Product with prescription drugs. Other capacities available. Optional accessories available. Product shipped in sealed lead case. Product escorted by U.S. military personnel. Specifications may be changed without notice. 1 week return. Allow 6-8 weeks for delivery. 30 day warranty begins on day of shipment. Supply of product may be limited. Taste, Color, and Smell may vary. Contents flammable. Contents under pressure. Contains CFC's. Product contents do not comply with EPA standards. Product eligible for parole in 6-8 months. No animals were harmed in the making of product. Product contains 50% animal fatty tissue. Offer only applies to new offers. Contains one or more of the following: Albatross, Beryllium, Carcinogens, Dung, Excrement, Funk, Guam, Hallucinogens, Igneous Rock, Joe, Korn, Lumber, Mike, Narcotics, Orange #5, Pork, Something Starting with a Q, Rust, Stool, Tubers, Unsanitized Waste, Velcro, Walrus, Xylophone, Yak, Zirconium. Product not responsible for conduct of Product. Late Night prices may vary. Product not sold after dark. Product ends at Date, or until supplies last. Only available at participating locations. With Approved Credit. Pricing available to qualifying commercial organizations. Estimated street prices. Product may not be for those who use Product on a regular basis. Not recommended for pregnant women. Proof of citizenship required for purchase. Use product at own risk. Damage may occur during shipment. Packaged by weight, not volume. Contents may settle during shipment. Other models available. 10% restocking fee on returned Product. Some assembly required. Syntax error in 105. For full functionality optional part #105 must be purchased. Part #105 not available in U.S. Part #105 may only be purchased in U.S. Do not use near heat or flame. Do not smoke until product is dry. Product is not associated with Product(TM) of Company. Product imported by Product Importers, Denver , Co. All major credit cards accepted. Product contains 3.2% alcohol by volume.
  • Or maybe just digitally sign the message.
  • The only thing I don't get is why anybody should consider it incomprehensible. The language is a bit beaurocratic, but I can understand it.

    "If you want to buy or sell stuff, don't use e-mail to tell us, cos we'll probably ignore it. Also, we might want to check up that it is you if you ask us to do anything by e-mail.

    "If you want us to give your stuff to other people or change your own details, write to us on real paper.

    "If you ask us to do stuff, it will be assumed you asked us at the time we first looked at your instructions. Even then, we might not do it straight away (and you won't complain). If you want us to do something quickly, or you don't want anybody else to know about it, don't use e-mail. Don't use e-mail for anything illegal.

    "If you do use e-mail, you realise that other people could read it or tamper with it, something could go wrong, you might get a virus, or it might just be late (if our inbound e-mail server is broken, for example)."

    Seems quite clear to me.
  • Actually, it's simpler than that. If people use PGP or S/MIME encryption, you cannot scan their e-mails for all that nasty un-PC stuff, or viruses or confidential information or libellous comments and so on.

    There has been at least one case (in the UK) of somebody using their company e-mail system to distribute defamatory material to his/her friends. The person who was the subject of the defamation sued the company for libel (which was deemed to be responsible for "publishing" the e-mail) and won.
  • Southwark Council includes encrypted mail along with rascist, sexist, defamatory content in their list of inappropriate content. Say *what*?? The world's general ignorance of PGP and encruyption is very depressing

    I suspect this is less a matter of ignorance and more a matter of possible liability for the Council under the lovely, fluffy, entirely-for-the-greater-good save-the-little-children draconian monstrosity that is the Regulation of Investigatory Powers Act. Remember that under UK (insane) law, non-disclosure of a password to any law-enforcement official who decides to ask for it, for any or no stated reason, can land someone with a 10 year prison sentence.

    And forgetting a password, or having never known it in the first place, or refusing to give it as the 'encrypted file' inquestion is not yours/not encrypted/a bunch of lost clusters, is implicitly stated in the Act to be no defence at all. Which is of course perfectly sane, reasonable, mature, civilised and a total affront to sanity.

    TomV

  • Does outlook HTML mangling count?

    My boss sent me an email that was 365 lines of message source for 20 lines of text.

  • yes, france (as I understand it) doesn't allow its citizens to use encryption (pgp, ssh, maybe others). this isn't just for crossing country borders, its internally within the country, as well.

    --
  • I still think the Borland Community has the stupidest disclaimer I've seen:

    The materials on this Site are copyrighted and protected by

    worldwide copyright laws and treaty provisions. You may
    download one copy of the information ("Materials") found
    on this Site on a single computer for your personal, non-
    commercial internal use only unless specifically licensed
    to do otherwise by Borland in writing.

    Now, that's what I call community building.

    M.

  • Digital Signatures

    Email disclaimers are a good thing, IMNSHO, but there seems to be a sort of haughtiness arms race when it comes to them, ESPECIALLY lawyers. It seems to me that they assume everyone in the world is out to steal their data, or misquote them, or misdirect their oh-so-vital documents.

    Are emails, from lawyers in particular, important?
    Yes.
    Is everything a lawyer says a pearl of wisdom?
    No
    If something is so important, either MD5 hash it for veracity, or encrypt it for privacy! This seems like an archaic solution to a new problem.

  • ... the words only stand up by the goodwill of the parties behind them...

    Too true, IRL & cyberspace. I keep telling everyone that the only disclaimer that makes sense on the Internet is:

    Disclaimer: Information sent via the Internet is subject to alteration and therefore cannot be trusted. Incidentally, I didn't write this.
  • Saw this once somewhere. I'm paraphrasing but...:
    ---
    This messages is copyright by me. License to distribute this message in part or in whole is $10,000 US. Permission is hereby given for everyone to distribute this message free of charge, excluding Microsoft.

    By reading, sending, copying, forwarding, or distributing this email via mean electronic or physical, by person or automatically by computer system/network you automatically agree to these terms.
  • your PROHIBITED

    That should read: "You're prohibited" (abbreviation from you are).
  • Just think, one day this will be -1, Redundant. :)

    ---
  • Its a shame people write that much in a disclaimer. If you want someone to read it, thus respecting it, KISS :)

    Although, i guess many licence agreements are not ment to be read, just used as backup when something goes wrong, something to fall back to if problems occur. Take napster as an example, they dont care if people copy music illegaly, because when they are used, they are not responsible.

    (KISS = Keep It Simple Stupid)

  • And as for the judges, the judge that found McDonalds liable for not warning some (fully grown and presumably employed) idiot that coffee is hot set a precedent (both in peoples minds and in a very legal sense) that ridiculous lawsuits could be won, even if there was no lasting damage.

    Don't beat around the bush, say what you really think. The issue as I see it is that common sense doesn't apply anymore -- and I blame the Kennedys for starting this crap. Clinton just added fuel to the fire. Let's look at how common sense has become a rare commodity in the United States of America:

    A farmer sets up a stepladder, a common tool used in homes and businesses by the millions. This is not the first time the farmer has used this tool. The purpose of using the tool was to fix a door on his barn. What the farmer failed to realize is that two legs of this common tool were on solid ground, while two legs were on a pile of manure he had built up over time. When he climbed the ladder, the manure gave way, the ladder pitched forward, and threw the farmer off. The result of his short flight was a broken leg.

    The farmer then sues the ladder manufacturer for negligence! It seems there was no warning on the ladder to ensure that all four legs are sitting on a firm surface. Result: $40K settlement in favor of the farmer.

    Now do you understand why so many products have so many labels that state the obvious to people with common sense?

    Your tax dollars at work.

  • It doesn't strike me as unusually fascist, but (un)usually stupid, since they say that the stuff in there may be confidential... If somebody transmits stuff by e-mail that are confidential, then they'd better make sure it's encrypted! :-) If they don't, you should be held legally responsible if the stuff ends up in the wrong hands, IMHO.
  • "We own all your disclaimer".

    krystal_blade

  • Well, I suppose I will be selling my first born to you. At least you didn't set a price :)

    Oh wait... I live in New Jersey.

    All my first born are not belong to you, sorry.

  • Take napster as an example, they dont care if people copy music illegaly, because when they are used, they are not responsible.

    I guess the last year they have spent in court and the millions in legal fees they have paid has proven that statement correct, huh?

    Kinda makes me wonder where the line is drawn before abuse becomes the companies liability and not the end users responsability.

  • by grammar nazi ( 197303 ) on Tuesday May 22, 2001 @03:30AM (#206581) Journal
    I don't think that these reports need to have these types of legal messages tagged to them. I tend to disagree with these types of messages altogether!

    All content, references, and ideas presented in this post are copyright 2001, grammar nazi. All rights reserved. You may reference or quote this comment in your own comment on Slashdot, however your PROHIBITED from quoting, referencing, or using ideas contained herein on other web forumns, both public and private. If you wish to print out the contents of this message and page. Please contact the grammar nazi at nospam@nospam.nospam [mailto].

  • Friend of mine used to work for a UK bank as a network admin. They had filters on to prevent any encrypted (PGP etc) mail from entering or leaving the mail system. Possibly understandble in a bank though... Kzip. __ "Any society that needs disclaimers has too many lawyers." - Erik Pepke
  • This one's from Christian Antkow of id Software (don't sue me please, if you sue me you will feel the power of MY disclaimer ;)

    Don't know why, but I like it :-)
    Here it is:

    *** Disclaimer: Opinions are my own and in no way reflect those of id Software
    This disclaimer does not cover misuse, accident, lightning, flood, tornado,
    tsunami, volcanic eruption, earthquake, hurricanes and other Acts of God,
    neglect, incorrect line voltage, improper or unauthorized use, broken antenna
    or marred cabinet, missing or altered serial numbers, removal of tag,
    electromagnetic radiation from nuclear blasts, sonic boom vibrations, customer
    adjustments that are not covered in this list, and incidents owing to an
    airplane crash, ship sinking or taking on water, motorvehicle crashing,
    dropping the item, falling rocks, thieving lawyers, crazy ex-girlfriends,
    leaky roof, broken glass, Y2K bug, mud slides, forest fire, or projectile
    (which can include, but not be limited to, arrows, bullets, shot, BB's,
    paintball, shrapnel, lasers, napalm, torpedoes, or emissions of X-rays, Alpha,
    Beta and Gamma rays, knives, stones, etc.).
  • All of your base are belong to us!

    The contents of this message do not reflect the views of Maximegalon University, Sirius Cybernetics, the Vogons or Natalie Portman [natalieportman.com]. Content may be considered factual in all or part within the context of an off camera utterance by George "Wooster" Bush in any or all parallel universes. All or part of this message may not be re-used without persimmon, under penalty of death, dismemberment, renoberation, a good firm spanking, a stern letter to your parents, or a poetry reading by Paula Nancy Millstone Jennings. Incidently, the attached virus, which is working its way through your hard-drive, scrambling its brains as only a Zygorthian space raider death-ray can closely simulate. Have a nice day.

    --
    All your .sig are belong to us!

  • by Glove d'OJ ( 227281 ) on Tuesday May 22, 2001 @04:01AM (#206587) Homepage
    A friend of mine (ok, my ex-wife!) is a genetic engineer... her sig file read:

    Jane Doe
    Office: 770.555.1212
    Mobile: 770.555.1213
    DNA Seq :
    tcgactgactgactggcgcgatcgacgagctcgatcgagaggctacgc gc
    gactgactgactggcgcgatcgacgagctcgatcgagaggctacgcgc ga
    gcgcgatcgacgagctcgatcgagaggctacgcgcgatattatcgcga tc
    tatcgcgatcgactgactgactggcgcgatcgacgagctcgatcgaga gg
    tcgactgactgactggcgcgatcgacgagctcgatcgagaggctacgc gc
    gactgactgactggcgcgatcgacgagctcgatcgagaggctacgcgc ga
    gcgcgatcgacgagctcgatcgagaggctacgcgcgatattatcgcga tc
    tatcgcgatcgactgactgactggcgcgatcgacgagctcgatcgaga gg
    tcgactgactgactggcgcgatcgacgagctcgatcgagaggctacgc gc
    gactgactgactggcgcgatcgacgagctcgatcgagaggctacgcgc ga
    gcgcgatcgacgagctcgatcgagaggctacgcgcgatattatcgcga tc
    tatcgcgatcgactgactgactggcgcgatcgacgagctcgatcgaga gg
    ...

    You get the idea.

    ---
    WWJD! WWJD! WWJD!
  • Sorry to follow up on my own post (and off-topic to boot), but I met Keith Henson on Monday.

    He's doing as well as can be expected exiled to the wilderness of Toronto. :^)Visual inspection revealed no nuclear weapons.
  • I'm waiting for an ingenious lawyer to decide to use a complex disclaimer, crammed with legal jargon in every email he sends, as advertising where, he hopes to drum up business by demonstrating his extraordinary grasp of legal language. I have a feeling that must have been what the guy who drafted the UBS Warburg disclaimer was thinking. I'm suprised that I didn't find a URL ana paragraph at the bottom advertising legal services.

    (laugh, it's funny)

    --
  • Their legal disclaimer on every page of their site [ubswarburg.com] makes no sense, and neither does their epic television commercials... can anyone explain them to me?
  • Southwark Council includes encrypted mail along with rascist, sexist, defamatory content in their list of inappropriate content. Say *what*?? The world's general ignorance of PGP and encruyption is very depressing. Someone (a C++ programmer, no less!) even asked me why my mail sig is "SHA1" ...
    --
    "I'm not downloaded, I'm just loaded and down"
    • Frivilous lawsuits exist because ordinary people bring idiotic things to court.

    What's your black-and-white take on lawyers working pro bono then? Vested interest, surely?

  • Congrats, I guess. My sister did her law degree there.
    -----------------
  • by CrackElf ( 318113 ) on Tuesday May 22, 2001 @03:44AM (#206614) Homepage
    Without all of the frivolous lawsuits abounding, disclaimers would not be necessary. Frivolous lawsuits exist because judges (x-lawyers) allow lawyers to bring idiotic things to court and win. The only way to be sure that you are not open to litigation from a lawyer is to hire another lawyer to look over your correspondence (and write disclaimers). No matter what, a lawyer gets money. It is a pretty good self perpetuating scam. Maybe I should have been a lawyer.
    -CrackElf
  • This comment must be destroyed within 30 minutes of reading under full penalty of U.S. law.

    How bout we just mod it down to -1. That is basically the same thing

The Force is what holds everything together. It has its dark side, and it has its light side. It's sort of like cosmic duct tape.

Working...