The Next X Prize 114
BlueCup writes "The X Prize Foundation, sponsor of a widely noted 2004 award for developing a reusable rocket suitable for private space travel, says it is now teaming with a wealthy Canadian geologist to offer $10 million to any team that can completely decode the genes of 100 people in 10 days. And that's not all. As an encore, the winning team will be paid $1 million more to decode another 100 people's genes, including a bevy of wealthy donors and celebrities. Already accepted for future decoding: Google Inc. co-founder Larry Page, Microsoft Corp. co-founder Paul G. Allen and former junk-bond king Michael Milken."
Will they decode Ballmer's genes as well? (Score:5, Funny)
See if they can find the chair-throwing gene...
Re: (Score:2)
Re:Will they decode Ballmer's genes as well? (Score:4, Funny)
Re: (Score:3, Funny)
Re: (Score:2)
I sure they find that gene that gets people stuck repeating same old jokes for years, although they are not funny.
Re: (Score:1)
Re: (Score:2)
What's the matter, Chuck? Cerebro broken? (Score:1)
This is the beginning of the end (Score:5, Insightful)
Welcome to the World of Tomorrow! Where only the obscenely rich can afford immortality for themselves and their families, and the rest of us are left out in the cold... we are called "invalids" with an icy, sneering indifference by the wealthy, geneticly gifted sons of Paul Allen and Larry Page.
Wake up people. There's a war on the horizon and the denying this technology to us proles us is going to be a major weapon.
Re: (Score:1)
Re: (Score:3, Insightful)
Calm down. Technology, if it is useful, invariably gets cheaper and hence more accessible. Once upon a time only the "rich" had cell phones. Only the "wealthy" had home computers. Only the "powerful" had access to the internet. Only the "elite" had access to medicines and health care. Cars were in the domain of the rich. Ditto air travel. The list goes on and on. Mark my words, if mapping your genomes
Re: (Score:2, Insightful)
Re: (Score:1)
Re: (Score:1)
Of course, if you have multiple genomes to map, I for one would like to talk to you as that would probably make for an interesting paper. (an individual has one and only one genome [wikipedia.org]).
Sorry, I know I'm a pain in the ass
Re: (Score:1)
Re: (Score:2)
Re: (Score:2)
Re: (Score:2)
Didn't know (Score:3, Funny)
Re: (Score:3, Funny)
Re: (Score:2)
As much as you joke, with all the patenting of the parts of the human genome, we'll have to see whether we'll be allowed to reproduce at all without breaking someone's patent...
We might be looking at some Genome Rights Management in the not-so-distant future...
Funny, that... I've maintained that humans should not be allowed to reproduce until they prove they're capable of taking care of the children, but this is getting too far even for me.
GRM (Score:3, Funny)
Re: (Score:3, Funny)
(Legal implications aside of course)
And to sweeten the deal (Score:4, Funny)
From TFA (Score:3, Interesting)
Hmmm... is there a gene (or a set of genes) responsible for, say, the desire to make huge amounts of money?
Or are there actual genes which determine how much introverted or extroverted a person is?
Of course, I don't think the rich and the famous are substantially different from the rest of you, but still... it's a valid question.
Re: (Score:2)
Re: (Score:2)
Re: (Score:2)
Re: (Score:1)
Perhaps you mean "conceived with it", since you have 9 months of nurture working on you by the time you're born. A crack baby may be born with an addiction, but that doesn't mean it's encoded in his genes.
Re: (Score:2)
I stand corrected.
Or should I say "hvala na ispravku".
Interesting sample group (Score:2)
I just wonder if we'll be able to isolate genes for sociopathy [fastcompany.com] from the sample group.
I mean, Michael Milken, the Junk Bond King? I know he's done a lot of charity work since then, but he, like some other people on that list, got where he is through highly unethical (sociopathic?) business behavior.
Re: (Score:1)
Re: (Score:2)
Of course, I don't think that money as such (or the desire for it) is encoded in our genes... but the greed, the lust for power... if they can be spotted in one's genes...
I'm not sure I'd like that, actually... imagine a world in which your job interview relies on your gene scan.
And if your personality doesn't fit the company... well, you're screwed.
Re: (Score:2)
First of all, it's Gattaca, not Gattica.
Even more accurately, GATTACA - it's a DNA sequence.
Besides, no company would select ruthless, greedy, back-stabbing S.O.B.s. They'd select determined, task-oriented people.
Explaining the distinction - or lack thereof - is left as an exercise for the student.
Frankly, I think I'd sooner believe horoscope than that kind of genetic screening. It's the devil I know.
Re: (Score:2)
I'll take the coach seats. (Score:3, Interesting)
Re: (Score:2)
The first batch costs $10,000 apiece. The second only costs $1,000 apiece.
By that logic, you only need to wait 40 days and you'll have your genome decoded for mere $10.
Wrong constraint (Score:1)
I'm sponsoring a prize too (Score:5, Funny)
Re: (Score:2)
You paying out a a million dollars to the winners?
Since this is Slashdot, I'll go with the odds and say that the only winner in this situation would be the poster.
Re: (Score:1)
Re: (Score:1)
Close. The poster is the only weiner in this situation.
1000 TB (Score:4, Interesting)
1000 TB is simply a petabyte. (Score:1)
Re: (Score:1)
When that happens, if you start seeing ads for mesothelioma everywhere, you'd better pay attention.
"wealthy Canadian geologist" (Score:2, Interesting)
Re: (Score:1)
Re: (Score:2)
Re: (Score:1, Informative)
Google "Fort McMurray"
Re: (Score:1)
Re: (Score:2)
Problem (Score:1)
They can decode me... (Score:1)
Man, this is scary! (Score:2)
Re: (Score:2)
Nope, data compression is where it's at. I want my genes 50% smaller!
(*sobs at making such a pathetic joke after my first choice was redundant*)
The smart inventor... (Score:1, Insightful)
They're trying to force 2 prizes in 1 here: (1) the ability to do the sequence of individuals en masse, (2) put a new/instant market and price cap on the invented tech from the get go.
First, why put a price cap on the new service at $10,000 a person, esp. for these wealthy individuals? It would be an artificial cap, for minimal gain. Second, they'd make more money from that same group of people with the "introductory price" when their tech comes out.
$10,000 Per Rich Bastard (Score:2, Funny)
The Next X Prize (Score:3, Funny)
Re: (Score:2)
Re: (Score:2)
Re: (Score:2)
It won't be long... (Score:1)
Nature vs. Nurture (Score:4, Informative)
In one of the largest Nature vs. Nurture shakeups, it was shown that the maternal behavior of the mother can cause epigenetic variations in the child that ultimately cause the child to grow up to become a nurturing mother or a non-nurturing mother (http://www.neurobio.ucla.edu/~lmp/Meaney.pdf [ucla.edu] ). This is one of the biggest breakthroughs in Neurobiology connecting specific epigenetic alterations to behavioral response (yes, there were controls, switching mothers/children, read the paper for the full details).
However, the genetic alterations here are not on the sequence level, but rather on the Epigenetic level (the state of the DNA). Therefore sequencing the genome of two identical twins who had different mothers (one nurturing, one non-nurturing), can lead to entirely different epigenetic levels, yet the sequences would be identical. The take home message here is that while the underlying sequence is important and full sequences will certainly help in the understanding of biology, the underlying state is just as important. This epigenetic variation is also one of the causes of cellular differentiation (stem cells, etc.), and also certain cancer types. In an effort to make my post slightly controversial, I'd go as far to say that a high throughput epigenetic snapshot is probably more important for understanding success in individuals than the underlying DNA sequence (however, it is my hope that a high-throughput sequencing approach would be a first step towards a high-throughput epigenetic approach, as they are tightly coupled in a sense)-- as well as providing great breakthroughs in other areas of biology (tissue regeneration, cancer treatement, etc.).
Great paper (Score:1)
Re: (Score:1)
Re: (Score:1)
However, the genetic alterations here are not on the sequence level, but rather on the Epigenetic level (the state of the DNA).
In other words: gene-expression. And? Where is the news here? How is this a "shakeup"? This strikes me as trite old long-known, well-understood stuff. Genes set the range over which you can turn out, but which genes are used and how and how much and how they're balanced against others -- well, that's management. Nurture. That's what "nature vs nurture" means.
You're light-skinne
What are the advantages? (Score:1)
Re: (Score:2)
It's the ability to quickly spot genetic variations that's important. For example, it may turn out that a small genetic variation partially determines the effectiveness of chemotherapy for a particular type of cancer. Say a particular chemotherapy shrinks the tumor in 60% of people who have an 'A' at position 12342245 on chromosome 1, but is completely ineffective in people who have a 'T' at that position. If you were
Why?!? (Score:2)
Re: (Score:1)
Not only that ... the private (read not-a-government) advancement of space technology and low-cost flights kind of made sense in a Gene Roddenbery sort of way.
On the other hand, ramping up the tech to rapidly decode bulk batches of DNA ... seems to only make sense in a George Orwell sort of way.
Can anyone enlighten me as to how this X Prize is going to make the world a better place? Are they hoping the winners will identify every gene?
What exactly does "decode" mean here? (Score:3, Interesting)
Re: (Score:1)
Re: (Score:2)
Decoding@Home (Score:1)
Re: (Score:1)
old news (Score:1)
Here you go... (Score:2)
Can I please have my money now ?
Re: (Score:1)
How do they check it you got it right? (Score:2)
atgactgactagctacacactcgatcatgcatatatttaaaacctactac cttaccttaaatttgggtactgagcgagaagctaactacgactacgcctc tagcatcgatcgtagcccatgctacgatgcatgcatcgatcgatcgatcg atcgatcgatcgatcgatgcactagcgcgcgtattatacggctagatcga tcgtagctagtcgatcgatgctacg
et
Re: (Score:1)
The current technology took over 10 years to decode one human gene set. At that rate, it would take over 1000 years to check the results for 100 people.
That was a while ago.
Our ability to directly read the human genome has been improving much faster than Moore's law.
(It will, however, ultimately become dependent upon and thus limited by Moore's law).
WTF is this good for? (Score:1, Troll)
Look, just
Re: (Score:2)
If you have a technology that can sequence that many individuals in that short a time, then you are in spitting distance of making
Re: (Score:1)
If this prize spurs advancement to what he thought was possible it is worth it.
Short summary - it will become cheap enough for everyone to get profiled (for good or bad).
The "no worries club" (Score:2)
All of them are people that wouldn't be effected by insurance companies refusing to insure them because of potential future health problems.
I can do that now... (Score:2)
Ok, so, here is what I decoded on the last 100 humans genes I looked at:
Organic
Yep, they all say the same thing. Gimme money.