Forgot your password?
typodupeerror

The Next X Prize 114

BlueCup writes "The X Prize Foundation, sponsor of a widely noted 2004 award for developing a reusable rocket suitable for private space travel, says it is now teaming with a wealthy Canadian geologist to offer $10 million to any team that can completely decode the genes of 100 people in 10 days. And that's not all. As an encore, the winning team will be paid $1 million more to decode another 100 people's genes, including a bevy of wealthy donors and celebrities. Already accepted for future decoding: Google Inc. co-founder Larry Page, Microsoft Corp. co-founder Paul G. Allen and former junk-bond king Michael Milken."
This discussion has been archived. No new comments can be posted.

The Next X Prize

Comments Filter:
  • by cp.tar ( 871488 ) <cp.tar.bz2@gmail.com> on Wednesday October 04, 2006 @12:40PM (#16307455) Journal

    See if they can find the chair-throwing gene...

  • Too bad there is not a more direct way to sift through humanity to find examples of Homo Superior.
  • by Anonymous Coward on Wednesday October 04, 2006 @12:43PM (#16307501)
    Maybe MY genes are worth decoding too, despite the fact that I'm not a C-level executive at a Fortune 500 company.

    Welcome to the World of Tomorrow! Where only the obscenely rich can afford immortality for themselves and their families, and the rest of us are left out in the cold... we are called "invalids" with an icy, sneering indifference by the wealthy, geneticly gifted sons of Paul Allen and Larry Page.

    Wake up people. There's a war on the horizon and the denying this technology to us proles us is going to be a major weapon.

    • by Verdict ( 625032 )
      Don't worry, there will always be lo-tech. Wealthy bodies are as vulnerable as poor ones. If we can just get our hands on a navy trained dolphin we should be alright.
    • Re: (Score:3, Insightful)

      There's a war on the horizon and the denying this technology to us proles us is going to be a major weapon.

      Calm down. Technology, if it is useful, invariably gets cheaper and hence more accessible. Once upon a time only the "rich" had cell phones. Only the "wealthy" had home computers. Only the "powerful" had access to the internet. Only the "elite" had access to medicines and health care. Cars were in the domain of the rich. Ditto air travel. The list goes on and on. Mark my words, if mapping your genomes

      • Re: (Score:2, Insightful)

        by evil_Tak ( 964978 )
        On a global scale, these things are still true.
      • if mapping your genomes is something you as an individual want

        Of course, if you have multiple genomes to map, I for one would like to talk to you as that would probably make for an interesting paper. (an individual has one and only one genome [wikipedia.org]).

        Sorry, I know I'm a pain in the ass :-)
        • by Nef ( 46782 )
          I realize what you're trying to say, but where would a chimera [wikipedia.org] fall in that description? Technically, a chimera should have at least 2 genomes right?
    • by iabervon ( 1971 )
      Your genes, Anonymous Coward, were sequenced by the Human Genome Project before anybody else's. But really, at $1m for 100 people at a prototype stage, this isn't hugely expensive (if anyone manages to make it cost-effective). Going into production from the prototype stage is commonly a factor of 100 drop in price, at which point, it's cheaper than going to the dentist.
    • I'm not sure I want my genes decoded. It would be interesting, and might turn up some possible health issues before they become a serious problem, but I don't think it would do me any good if that data fell into the hands of my insurer or the government, or even some group I haven't imagined that hates one of my ancestors or something.
  • Didn't know (Score:3, Funny)

    by Esion Modnar ( 632431 ) on Wednesday October 04, 2006 @12:43PM (#16307507)
    they were encrypted.
    • Re: (Score:3, Funny)

      by ronadams ( 987516 )
      Yeah, Sony and Microsoft partnered to create Digital Rights Management for Humans. We should be careful, though. As I understand the EULA, if we attempt to decode Paul Allen's genetic code without purchasing a license to his soul, he might be obiliterated. Not to mention that we'd be stealing all the thousands of years of God's hard work. Didn't you watch that commercial before the last movie you went to?
      • by cp.tar ( 871488 )

        As much as you joke, with all the patenting of the parts of the human genome, we'll have to see whether we'll be allowed to reproduce at all without breaking someone's patent...

        We might be looking at some Genome Rights Management in the not-so-distant future...

        Funny, that... I've maintained that humans should not be allowed to reproduce until they prove they're capable of taking care of the children, but this is getting too far even for me.

      • GRM (Score:3, Funny)

        by Mateo_LeFou ( 859634 )
        Actually Sony's Gene Rights Management technology rootkits your own genes, so that if you attempt to copy Steve Allen's DNA without permission they can basically turn you into someone else.
        • Re: (Score:3, Funny)

          So if I reverse engineer this GRM rootkit properly I can turn myself into whoever I want? Say, Chuck Norris? Sweet...

          (Legal implications aside of course)
  • by krell ( 896769 ) on Wednesday October 04, 2006 @12:46PM (#16307567) Journal
    "And to sweeten the deal, we've hidden special codes somewhere the spleen section section of the genes of everyone on earth. Make sure to check these codes at www.mountaindew.com to win your free iTunes music: and one prize winner WILL RECEIVE A NEW NISSAN XTERRA!"
  • From TFA (Score:3, Interesting)

    by cp.tar ( 871488 ) <cp.tar.bz2@gmail.com> on Wednesday October 04, 2006 @12:51PM (#16307621) Journal
    Are the rich and famous really different from the rest of us, down in their genes?

    Hmmm... is there a gene (or a set of genes) responsible for, say, the desire to make huge amounts of money?
    Or are there actual genes which determine how much introverted or extroverted a person is?

    Of course, I don't think the rich and the famous are substantially different from the rest of you, but still... it's a valid question.

    • by dptalia ( 804960 )
      The drive to be an entrepeneur is like the drive to be creative - you're born with it or not. Whether you can see it in your genes is another question.
      • by cp.tar ( 871488 )
        If it can't be seen in your genes, are you really born with it?
        • by dptalia ( 804960 )
          Good question. It brings back the whole nature versus nuture debate. I'm not sure how much is just the way you are, but I know kids can be raised the same way and turn out differently. How much is inheirent in their genes?
        • If it can't be seen in your genes, are you really born with it?

          Perhaps you mean "conceived with it", since you have 9 months of nurture working on you by the time you're born. A crack baby may be born with an addiction, but that doesn't mean it's encoded in his genes.

    • Hmmm... is there a gene (or a set of genes) responsible for, say, the desire to make huge amounts of money?

      I just wonder if we'll be able to isolate genes for sociopathy [fastcompany.com] from the sample group.
      I mean, Michael Milken, the Junk Bond King? I know he's done a lot of charity work since then, but he, like some other people on that list, got where he is through highly unethical (sociopathic?) business behavior.
    • Given highly advanced biomolecular engineering, you probably could engineer in a desire for money. That said, money is an *extremely* recent concept in the grand scheme of things. I think you'd have a much better chance finding genes that ***correlate*** with greed, loose morals, sex-addiction, power-addiction, etc. Overall, I think you'd find that such things are mostly environmental and luck-based. I mean, most people who *want* to get rich aren't. And genes only predispose you to things. Almost all
      • by cp.tar ( 871488 )

        Of course, I don't think that money as such (or the desire for it) is encoded in our genes... but the greed, the lust for power... if they can be spotted in one's genes...

        I'm not sure I'd like that, actually... imagine a world in which your job interview relies on your gene scan.
        And if your personality doesn't fit the company... well, you're screwed.

    • by PeelBoy ( 34769 )
      I don't know, but I wouldn't mind being able to say that I personally decoded the genes of a bunch of rich and famous people. The 10 million dollars sounds pretty nice too.
  • by Verdict ( 625032 ) on Wednesday October 04, 2006 @12:52PM (#16307635)
    So a hundred wealth donors only had to put up 10,000 to get their genes decoded in 10 days? That means I can sign up for the 100 day process for only $1000, and the 1000 day process for just $100. I can wait three years.
    • by cp.tar ( 871488 )

      The first batch costs $10,000 apiece. The second only costs $1,000 apiece.

      By that logic, you only need to wait 40 days and you'll have your genome decoded for mere $10.

    • I think they screwed up the constraint - its not time but chemical/enzyme costs that currenly make such a thing infeasible. Its not obvious that the costs of sequencing a genome is less then $10000K in raw materials, ignoring capital and labor constraints.
  • by Anne_Nonymous ( 313852 ) on Wednesday October 04, 2006 @12:52PM (#16307653) Homepage Journal
    I'm sponsoring the XXX prize for two women willing to accept my genetic code at the same time.
  • 1000 TB (Score:4, Interesting)

    by fragles ( 968177 ) on Wednesday October 04, 2006 @12:55PM (#16307697) Homepage
    You just need to buy lot of 454 sequencing devices (http://www.454.com/) or Solexa http://www.solexa.com/wt/page/index [solexa.com] and have big datacenter. Then you use those sequencers to re-sequence those 100 people and compare them with the reference human sequence. Big datacenter - You will need 30 Solexa devices and around 1000 TB data storage this is a nice task for Google datacenter.
  • by Anonymous Coward
    how does one become a wealthy geologist?
  • Its still way down the line as far as cures. Because as they have found combinations of genes have other functions within the body. Hence "yes we found the gene for asthma!" but if they alter that gene it will have many affect to other functions. This is one of the current problems they have been trying to figure out. Yes its still a benefit but we still have many other obstacles.
  • They can decode my DNA for the sale price of $500K
  • Now, where can I go to get my genes encrypted?
    • Just ignore my above comment, because another poster already mentioned encryption.

      Nope, data compression is where it's at. I want my genes 50% smaller!

      (*sobs at making such a pathetic joke after my first choice was redundant*)
  • by Anonymous Coward
    ...would not take the encore--$1mil for the 100 extra.

    They're trying to force 2 prizes in 1 here: (1) the ability to do the sequence of individuals en masse, (2) put a new/instant market and price cap on the invented tech from the get go.

    First, why put a price cap on the new service at $10,000 a person, esp. for these wealthy individuals? It would be an artificial cap, for minimal gain. Second, they'd make more money from that same group of people with the "introductory price" when their tech comes out.
  • Given you can't do crap for $10K these guys are getting a pretty good deal. As for our genetic differences, I've seen the pictures of Larry Page in a speedo and I am proud to say we have clear genetic differences.
  • by BigCheese ( 47608 ) <dennis.hostetler@gmail.com> on Wednesday October 04, 2006 @01:08PM (#16307965) Homepage Journal
    Wouldn't that be the 'Y' prize? They had better make it take a while. There's only one left.
  • Nature vs. Nurture (Score:4, Informative)

    by Nutty_Irishman ( 729030 ) on Wednesday October 04, 2006 @01:26PM (#16308277)
    Before this turns into a large nature vs. nurture argument, I thought I'd pipe in here with a really great paper that really throws a wrench into the argument.

    In one of the largest Nature vs. Nurture shakeups, it was shown that the maternal behavior of the mother can cause epigenetic variations in the child that ultimately cause the child to grow up to become a nurturing mother or a non-nurturing mother (http://www.neurobio.ucla.edu/~lmp/Meaney.pdf [ucla.edu] ). This is one of the biggest breakthroughs in Neurobiology connecting specific epigenetic alterations to behavioral response (yes, there were controls, switching mothers/children, read the paper for the full details).

    However, the genetic alterations here are not on the sequence level, but rather on the Epigenetic level (the state of the DNA). Therefore sequencing the genome of two identical twins who had different mothers (one nurturing, one non-nurturing), can lead to entirely different epigenetic levels, yet the sequences would be identical. The take home message here is that while the underlying sequence is important and full sequences will certainly help in the understanding of biology, the underlying state is just as important. This epigenetic variation is also one of the causes of cellular differentiation (stem cells, etc.), and also certain cancer types. In an effort to make my post slightly controversial, I'd go as far to say that a high throughput epigenetic snapshot is probably more important for understanding success in individuals than the underlying DNA sequence (however, it is my hope that a high-throughput sequencing approach would be a first step towards a high-throughput epigenetic approach, as they are tightly coupled in a sense)-- as well as providing great breakthroughs in other areas of biology (tissue regeneration, cancer treatement, etc.).
    • This sort of research really lays low the idea often trumpeted in the popular media that totally decoding the genome will immediately open the door to genetic therapies and cures for hereditary diseases. Between epigenetic modification of DNA and the existence of micro-RNA based expression control, we're finding that there's a lot more subtlety and intricacy in how genes work than we would have guessed 10-15 years ago.
    • by cds0922 ( 42282 )
      There is a high-throughput project to look at epigenetic markers in humans. Its called the ENCyclopedia Of DNA Elements (ENCODE) project (http://genome.gov/10005107 [genome.gov]) in which 10% of the human genome is being studied in extream detail for a variety characteristics including the best understood epigenetic marks (histone modification, DNA methylation etc).
    • However, the genetic alterations here are not on the sequence level, but rather on the Epigenetic level (the state of the DNA).

      In other words: gene-expression. And? Where is the news here? How is this a "shakeup"? This strikes me as trite old long-known, well-understood stuff. Genes set the range over which you can turn out, but which genes are used and how and how much and how they're balanced against others -- well, that's management. Nurture. That's what "nature vs nurture" means.

      You're light-skinne

  • So, asides from the coolness factor, what are the real advantages of decoding your genes?
    • o, asides from the coolness factor, what are the real advantages of decoding your genes?

      It's the ability to quickly spot genetic variations that's important. For example, it may turn out that a small genetic variation partially determines the effectiveness of chemotherapy for a particular type of cancer. Say a particular chemotherapy shrinks the tumor in 60% of people who have an 'A' at position 12342245 on chromosome 1, but is completely ineffective in people who have a 'T' at that position. If you were

  • The original X-prize was to encourage development in an area without much activity and where it was small companies already doing the work. I'm sure Celera Genomics could win this prize more easily than anyone. What do they need with $10M? There are billions being suck into genomics research, why would anyone think another $10M is going to accomplish anything other than publicity?
    • Not only that ... the private (read not-a-government) advancement of space technology and low-cost flights kind of made sense in a Gene Roddenbery sort of way.

      On the other hand, ramping up the tech to rapidly decode bulk batches of DNA ... seems to only make sense in a George Orwell sort of way.

      Can anyone enlighten me as to how this X Prize is going to make the world a better place? Are they hoping the winners will identify every gene?

  • by m0nstr42 ( 914269 ) on Wednesday October 04, 2006 @01:42PM (#16308595) Homepage Journal
    Maybe TFA is more precise, or maybe it's more obvious to someone who does genetics, or maybe I'm tragically out of the loop, but what exactly does it mean to "decode" the genes of 100 humans? It seems like the real "decoding" would be to look at the ensemble of human genomes and match sequences and combinations of sequences in certain locations with specific phenotypes. That is, after all, the Holy Grail of genetic research isn't it? Given that information, looking at any given person's DNA and classifying their phenotype should be a more-or-less trivial task. Maybe it is the pure procedural/logistical problem of processing that much information in that amount of time that they are after?
    • I was really wondering that myself. Have we ever done this completely for a single individual, matched the entire genotype to the phenotype? Surely that can't be what they're proposing?
      • I'm pretty sure that most of the human genome is unknown. Although, having the complete genome of another 100 people matched with their identities/characteristics would probably make figuring out genotype/phenotype matchings a lot easier. If you had, say, 100,000+ (which would probably be reasonable if someone develops a method cheap enough to win this X-prize), then you could probably find some very strong relations between sets of genes and characteristics of the person.
  • My prediction is that someone creates a client similar to a folding@home client. They might offer a chance to get paid for your work if they happen to win. Seems to make sense to me.
  • i read about this in popular science atleast a month ago...
  • AGGTACCCATGGTAAACCCGTGC...

    Can I please have my money now ?

  • The current technology took over 10 years to decode one human gene set. At that rate, it would take over 1000 years to check the results for 100 people. I'm not willing to wait that long to collect my prize. And if they're not checking the results then here's my submission:

    atgactgactagctacacactcgatcatgcatatatttaaaacctactac cttaccttaaatttgggtactgagcgagaagctaactacgactacgcctc tagcatcgatcgtagcccatgctacgatgcatgcatcgatcgatcgatcg atcgatcgatcgatcgatgcactagcgcgcgtattatacggctagatcga tcgtagctagtcgatcgatgctacg

    et

    • The current technology took over 10 years to decode one human gene set. At that rate, it would take over 1000 years to check the results for 100 people.

      That was a while ago.

      Our ability to directly read the human genome has been improving much faster than Moore's law.

      (It will, however, ultimately become dependent upon and thus limited by Moore's law).

  • OK, a prize for first-to-space-in-a-private-rocket sorta made sense. But this "give me 100 gene profiles right now" stuff? What possible use is it to be able to sequence that many individuals of a single species in a short time? The only practical value worth that kind of money is genetic profiling; sort of the Nazi eugenics approach to social purification, but on steroids, with none of that messy subjective stuff like whose brow sticks out the furthest, or nose is largest, or jaw is most rugged.

    Look, just
    • What possible use is it to be able to sequence that many individuals of a single species in a short time? The only practical value worth that kind of money is genetic profiling; sort of the Nazi eugenics approach to social purification, but on steroids, with none of that messy subjective stuff like whose brow sticks out the furthest, or nose is largest, or jaw is most rugged.

      If you have a technology that can sequence that many individuals in that short a time, then you are in spitting distance of making

    • by tqft ( 619476 )
      I suggest you look up RPF's comments on gene technology.

      If this prize spurs advancement to what he thought was possible it is worth it.

      Short summary - it will become cheap enough for everyone to get profiled (for good or bad).
  • Google Inc. co-founder Larry Page, Microsoft Corp. co-founder Paul G. Allen and former junk-bond king Michael Milken

    All of them are people that wouldn't be effected by insurance companies refusing to insure them because of potential future health problems.
  • Let me just get out my codebook...

    Ok, so, here is what I decoded on the last 100 humans genes I looked at:

    Organic

    Yep, they all say the same thing. Gimme money.

Each new user of a new system uncovers a new class of bugs. -- Kernighan

Working...