I think the word "crap" is a little harsh. "It was acknowledged from the outset that some of the data might not hold up, because papers were deliberately selected that described something completely new, such as fresh approaches to targeting cancers or alternative clinical uses for existing therapeutics" These might have been "landmark" papers (whatever that means), but that doesn't mean that the conclusions will hold up in every model or in every application. A finding in one type of cancer cell (or inbred strain of worm, fly, mouse, rabbit, ape, etc.) will not necessarily directly lead to an effective therapy for humans. If scientists are afraid to publish risky results that have never been observed before, then scientific progress will slow down.

I think you are looking at this the wrong way. If anything it is more difficult to publish results that are consistent with other studies because there isn't much interest (unless it is controversial). Studies have a better chance of being published in high-impact (widely read) journals if they report something new that causes a change in the way the scientific field thinks.

The article says that the "authors will pay for validation studies themselves" at first. This is a nice idea, but it is not practical in an academic setting. Academic labs would rather spend money on more people or supplies instead of paying an independent lab to replicate data for them. New ideas are barley able to get funding these days, so why would extra grand money be spent to do the same exact studies over again. There could be a use for this in industry, but they would probably pay their own employees to do this instead if it is worth it.

If you think this is cool, then you should look up the work of Dr. Jason Shear at the University of Texas (http://jshear.cm.utexas.edu/jshear/). His laboratory designs cages/houses/traps for bacteria. One of his papers that I am familiar with is "Probing Prokaryotic Social Behaviors with Bacterial 'Lobster Traps'" (http://mbio.asm.org/content/1/4/e00202-10.full).

I can't find the reference, but there was a paper published that studied the stability of microRNAs with RNAses and found that they were more resistant than longer RNA species. There is a paper that was published earlier this year that reported an estimated miRNA average half-live of 119 hours, with some over 200 hours, inside cells (Gantier, M.P. et al. Analysis of microRNA turnover in mammalian cells following Dicer1 ablation. Nucleic Acids Research (2011). It is possible that the study could've underestimated the half-life since other groups have reported that microRNAs have enhanced stability in the presence of Dicer and the study I mentioned calculated the half-life in its absence. I haven't had a chance to read the paper referenced in TFA, so I can't speak to how believable it is yet. I'm sure that many labs (and companies) will start looking into this and its impact on their favorite disease or to try to modify their favorite food to knock-out harmful microRNAs or express helpful ones.

A multiple research groups have targeted CCR5 using gene therapy before. An old (2007) review details the methods a number of groups have been trying including Carl June (you may remember his name from the leukemia story involving the HIV-vector). Building an HIV-Proof Immune System: http://www.sciencemag.org/content/317/5838/612.full

T cells with chimeric antigen receptors have potent antitumor effects and can establish memory in patients with advanced leukemia. http://www.ncbi.nlm.nih.gov/pubmed/21832238 Chimeric antigen receptor-modified T cells in chronic lymphoid leukemia. http://www.ncbi.nlm.nih.gov/pubmed/21830940

Did the Church suppress science? "I, Galileo, son of the late Vincenzio Galilei, Florentine, aged 70 years, arraigned personally before this tribunal, and kneeling before You, Most Eminent and Reverend Lord Cardinals, Inquisitors-General against heretical depravity throughout the Christian commonwealth, having before my eyes and touching with my hands the Holy Gospels, swear that I have always believed, I believe now, and with God's help I will in future believe all that is held, preached, and taught by the Holy Catholic and Apostolic Church. But whereas - after having been admonished by this Holy Office entirely to abandon the false opinion that the Sun is the centre of the world and immovable, and that the Earth is not the centre of the same and that it moves, and that I must not hold, defend, nor teach in any manner whatever, either orally or in writing the said false doctrine..." I may be thinking in absolutes, but "Galileo's political antagonism" does not justify this forced retraction.

If this is the paper from the article, then "[The] work was supported in part by National Institutes of Health Grant GM-22778." Lu M, Steitz TA. Structure of Escherichia coli ribosomal protein L25 complexed with a 5S rRNA fragment at 1.8-A resolution. Proc. Natl Acad. Sci. USA. 2000;97:2023–2028 (http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=24423)

In case anyone wants the GFP sequence: atggtgagcaagggcgaggagctgttcaccggggtgg tgcccatcctggtcgagctggacggcgacgtgaacgg ccacaagttcagcgtgtccggcgagggcgagggcgat gccacctacggcaagctgaccctgaagttcatctgca ccaccggcaagctgcccgtgccctggcccaccctcgt gaccaccctgacctacggcgtgcagtgcttcagccgc taccccgaccacatgaagcagcacgacttcttcaagt ccgccatgcccgaaggctacgtccaggagcgcaccat cttcttcaaggacgacggcaactacaagacccgcgcc gaggtgaagttcgagggcgacaccctggtgaaccgca tcgagctgaagggcatcgacttcaaggaggacggcaa catcctggggcacaagctggagtacaactacaacagc cacaacgtctatatcatggccgacaagcagaagaacg gcatcaaggtgaacttcaagatccgccacaacatcga ggacggcagcgtgcagctcgccgaccactaccagcag aacacccccatcggcgacggccccgtgctgctgcccg acaaccactacctgagcacccagtccgccctgagcaa agaccccaacgagaagcgcgatcacatggtcctgctg gagttcgtgaccgccgccgggatcactcacggcatgg acgagctgtacaagtaa