Forgot your password?

typodupeerror

Comment: Re:Burn Notice (Score 1) 126

by RockDoctor (#44047879) Attached to: DNA Fog Helps Identify Trespassers, Thieves, and Brigands
I don't know what "Burn Notice" is, but this does sound very similar to the idea of "SmartWater" (leaving stains of lots of fluorescent dyes in unique combinations, 20 distinct dyes enabling a million distinct tags) from 20 years ago. And explosive tracing from the decade before (shreds of plastics in the explosive ; enough survive to provide a fingerprint. And enough to contaminate the whole environment.)

Remember when having traces of cocaine on a five-pound note was sufficient to get you jailed?

Comment: Re:Mad Scientist (Score 1) 126

by RockDoctor (#44047837) Attached to: DNA Fog Helps Identify Trespassers, Thieves, and Brigands

That way DNA evidence will become worthless as it will appear that the population of large nations was in the room not to mention the expense of sorting all the DNA samples.

Which is why the DNA tags that they use contain biologically impossible DNA sequences. Or at least ones of implausibly low probability, such as (I construct a mapping of ASCII letter codes onto A="00", C="01", G="10", T="11" ; build a look-up table, make a translator ... for upper case only) "CCATCATACAACCCATCAGACACACATTCCCAAGAACCATCCCCCAATCAGTCCATAGAC" , which should encode "SLASHDOT SUCKS!" and is fairly unlikely to occur in any existing organism on the planet. (Google can't find it. Not surprised. Anyone know how to use sequence databases?)

Whether that would make a protein, I don't know. It may have several STOP codons in it (I don't have my lookup table of DNA tuples to amino acid and STOP codons to hand).

What you'd need to do would be to get a number of their DNA samples and try to work out their encoding scheme (it's likely to be based on ASCII, and therefore need 4 bases per character, while natural DNA is based on 3-base sets ; that alone will mark it as "unnatural" ; perhaps they start every strand with "copyright WHOEVER 2013" ; you'll need a fairly large sample - a few microgrammes perhaps). Then create a lot more "spam DNA" using the same encoding scheme. Then contaminate everywhere.

Oh, sorry, I wandered off into an attack on this scheme in particular, not your scheme of attacking DNA evidence in general. Hmmm. you'd need a fair source of random human DNA. A minor bit of lab work (to snip the DNA into the sort of strands used in "fingerprinting"), and then some genetic engineering to reproduce the mix of strands you've got - say by brewing yeast. Getting X million sets of fingerprint strands into a single brew-able organism would be a hard job. But if you sampled (say) the towels of the Barcelona FC changing room, you could have your victim having shagged the whole squad on the night that you did him. Which could be ... embarrassing, considering the number of footballers in the DNA databases. Should be do-able. Highly illegal (the charge here would be "conspiring to defeat the ends of justice"), hard to argue that it happened by accident, but it should be doable on a "football squad basis.

And the forensic teams would respond by searching the swabs for a single intact sperm, PCR-ing that up to fingerprintability, and fucking you that way. If they don't do that already.

Incidentally, I've expanded my "translator" to handle phrases now, and to "handle" lower case characters the easy way. So the copyright statement might look like this: CAATCATTCCAACCGC CCAGCAGCCACTCAGA CCCAAGAACCCTCAGA CATTCACCCCCGCACC CCAGAGAAATAGATAA ATACATAT

Comment: Re:Swab the door handle (Score 1) 126

by RockDoctor (#44047605) Attached to: DNA Fog Helps Identify Trespassers, Thieves, and Brigands

If they find the DNA on the door handle, it would be easy to get a warrant based on that evidence.

Which is why you took your gloves off before touching the door. Or you put them on, depending on which way you want to do the containment. Either way would work, but one carries evidence of forethought and planning.

Comment: Re:Scenario (Score 1) 126

by RockDoctor (#44047587) Attached to: DNA Fog Helps Identify Trespassers, Thieves, and Brigands
  • (1) you're already guilty for being at the crowd which became a riot ; your intentions are irrelevant, the crime is one of strict commission. The Riot Act was read ; the crowd was ordered to disperse ; you were there, as witnessed by the presence of the tags ; you're guilty. End of facts (unless you're going to dispute those facts, see below) ; start of sentencing phase.
  • (2) "and then swab your door handle on their way out." Why did you let them in. You're not obliged to let them in without a warrant. So don't (w.a.w). Ever (w.a.w). Not for any reason, including a search for a missing cat (w.a.w).
  • (3) see standard forensic awareness techniques posted above. Plan for them before the event and carry them through after the event.
  • (4) when the water cannon and/ or tear gas (tagged, whatever) starts flowing, catch as much as you can and then go and drip it over public transport, sit on park benches, go to the library ; spread the taggant as widely as possible so that everybody in the city is tagged regardless of their actual activities that day.

    Item (4) allows you to dispute item (1) ; you've broken (or introduced "reasonable doubt" to) the assertion that "this tag means presence at the riot".

    Didn't they teach you anything in school in the 1980s?

Comment: Re:I thought bleach destroyed that stuff. (Score 1) 126

by RockDoctor (#44047529) Attached to: DNA Fog Helps Identify Trespassers, Thieves, and Brigands
You are ignorant of the fact that "forensically aware" criminals have been doing this for years already? All this will do is add a washdown with a detergent-oxidising agent mix to the normal procedures of using clothing from the second-hand shop (if you can't use a painter's white paper suit, or a burka as a recent armed robbery in London did), laundering it or burning it as soon as possible after the crime (if you're going to "torch" the "motor" ... do all your clothes too).

The only reason for criminals to get caught through forensics these days is through either failure to do their research, inattention to detail, failure to follow through procedures, or failure to launder the proceeds after the crime. i.e., sheer bloody stupidity. Which is common enough in the criminal fraternity, because if they can do things like that, they're bright enough to make more money through regular work.

Comment: Re:The end of crime (Score 1) 126

by RockDoctor (#44047461) Attached to: DNA Fog Helps Identify Trespassers, Thieves, and Brigands

Any surface that is non-sterile is filled with nucleases released by microorganisms and endogenous enzymes from the human body that will quickly degrade your DNA beyond recognition.

"degrade" , yes ; "beyond recognition", no.

Forensic scientists and archaeologists - in fact, almost anyone who works with DNA and isn't a medic - are well used to working with contaminated, multiple-source DNA samples. It does make the job harder (which is why in the real world you'll only hear DNA evidence presented as probabilities of supporting this hypothesis over that hypothesis), but not impossible.

I gather that there are a suite of TV programmes with names like "CSI" which might give you a different impression. These are fictional constructs.

Comment: Re:kill them all (Score 1) 122

by RockDoctor (#44047399) Attached to: Saudi Arabia Set To Ban WhatsApp, Skype

There are some people who are only Muslims because leaving Islam is punishable by death, by law in most Islamic countries

"many" Islamic countries I'd agree with, but I'm much more dubious about "most". And as someone who has gone to a number of such countries in the past, who will do in the future, who has had to declare my religion (atheist) on government documents repeatedly (as well as surrendering my passport before going out to work), I pay reasonably close attention to such issues. Which is part of the reason that I may have to be getting a second passport soon. Or perhaps take out dual-nationality AND getting a second passport.

Ideally all Muslims would realise that Islam is just the ravings of a power-mad pedophile war lord

"power-mad", check ; "war lord", check (so far, so different, for all national leaders of his time) but the paedophile allegation may be true by the standards of our time, but it wasn't even unusual by the power-politics standards of his time (e.g. Henry-8 of England trying to marry his 7-year-old son to the 2 year old Mary Queen of Scots)

has no place in a civilised world

I keep on looking for that. Do you have an address? And a space ship?

Comment: Obligatory Niven quote : (Score 1) 358

Just to put this "Man of Steel" character into context, from a 1971 essay by "Grand Old Man of SF" Larry Niven entitled "Man of Steel, Woman of Kleenex" :

Consider the driving urge between a man and a woman, the monomaniacal urge to achieve greater and greater penetration. Remember also that we are dealing with kryptonian muscles.

Superman would literally crush LL's body in his arms, while simultaneously ripping her open from crotch to sternum, gutting her like a trout.

IV

Lastly, he'd blow off the top off of her head.

I gather (from puff pieces like this submission on Slashdot) that there may be yet another Superman movie in progress. Is it likely to address these important parts of the myth, AND be worth watching?

Comment: Lost improvement opportunity ... (Score 1) 416

The ... program helped the NSA stop a 2009 al-Qaida plot to blow up New York City subways.

Given that bitching about the public transport system is a perennial subject in every city that I've visited (even Seoul and Munich ! ), doesn't that make Al Quaeda the good guys and the NSA the bad guys?

OK, you'd have had to get them to carry out their re-development at breakfast time for Riyadh. But since the redevelopers would most likely have been Saudis, and being religious, they'd have been as thick as coagulated pigshit, then that shouldn't have been too difficult.

Comment: Re:wtf (Score 1) 639

by RockDoctor (#44047189) Attached to: Supreme Court Decides Your Silence May Be Used Against You
I thought that the term in your constitution was about "inalienable rights"? Which means that nobody can take them away from you, and you can't give them away either.

But I'm neither American (for which I give thanks) nor a lawyer (for which I give additional thanks). So I'm not going to lose any sleep if I turn out to be wrong.

"If you are afraid of loneliness, don't marry." -- Chekhov

Working...